![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RESEARCH COMMUNICATION
1 Cancer Biology and Genetics Program, Memorial Sloan-Kettering Cancer Center, New York, New York 10021, USA; 2 Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724, USA; 3 Department of Biochemistry and McGill Cancer Center, Montreal, Quebec H3G 1Y6, Canada; 4 Department of Genetics, Osaka University, Osaka 565-0871, Japan; 5 Department of Pathology, Memorial Sloan- Kettering Cancer Center, New York, New York 10021, USA; 6 Howard Hughes Medical Institute, Cold Spring Harbor, New York 11724, USA
 |
Abstract |
|---|
 Top Abstract Results and DiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
[Keywords: Mouse model; tumorigenesis; apoptosis; translation; signaling]]
revised version accepted October 24, 2007.
). While each of these lesions affects additional processes, enforced expression of certain translation factors transforms rodent fibroblasts and promotes tumorigenesis (Lazaris-Karatzas et al. 1990; Ruggero et al. 2004; Wendel et al. 2004). Similarly, small molecules that target these pathways suppress protein translation and have anti-tumor effects (Dilling et al. 1994; Wendel et al. 2004). Thus, deregulation of translation is an important step in oncogenic transformation and may contribute to tumor maintenance.
Most protein translation involves assembly of the eIF4F translation initiation complex on the 5' cap structure, followed by recruitment of ribosomal subunits and their associated factors (for review, see Hay and Sonenberg 2004). The eukaryotic translation initiation factor eIF4E contributes to the eIF4F complex, and its activity is controlled by mammalian target of rapamycin (mTOR) through phosphorylation of the eIF4E-binding proteins (4E-BP). mTOR-mediated phosphorylation of 4E-BP liberates eIF4E allowing it to enter the eIF4F complex. Although eIF4E is a general translation factor, it preferentially enhances translation of a subset of mRNAs with complex 5' untranslated regions (UTRs). These include a number of transformation-related and survival genes (Rajasekhar et al. 2003; Mamane et al. 2007).
eIF4E is overexpressed in several tumors and has been linked to patient prognosis (for review, see Ruggero and Pandolfi 2003). Although the molecular basis underlying these associations is unknown, eIF4E affects cancer-relevant processes such as apoptosis (Polunovsky et al. 2000) and senescence (Ruggero et al. 2004), and acts as an oncogene alone or in combination with c-Myc (Lazaris-Karatzas et al. 1990; Ruggero et al. 2004; Wendel et al. 2004). Presumably, these functions reflect the ability of eIF4E to affect translation although other eIF4E-related functions may be required (Ruggero and Pandolfi 2003).
eIF4E is a target of PI3K and mitogen-activated protein kinase (MAPK) signaling, and may act as a convergence point for these pathways. Thus, the PI3K pathway leads to enhanced eIF4E activity via release from the 4E-BPs and ERK or p38/MAPK can increase phosphorylation of eIF4E via MNK1/2 (Waskiewicz et al. 1997). However, the biological significance of eIF4E phosphorylation and its effect on translation is controversial (for review, see Scheper and Proud 2002). In Drosophila eIF4E phosphorylation seems important for normal development (Lachance et al. 2002); mice with deletions in both Mnk kinases develop normally without detectable eIF4E phosphorylation (Ueda et al. 2004).
We previously used adoptive transfer methods to show that eIF4E is a potent oncogene in the Eµ-Myc transgenic mouse lymphoma model, producing aggressive and drug resistant tumors (Wendel et al. 2004). Here, we use the same model to further study eIF4E promotes tumorigenesis, identifying a regulatory role for the MNK kinases and one downstream effector, Mcl-1. These studies underscore the importance of eIF4E phosphorylation during oncogenesis, and identify a point of translational regulation that is a potential therapeutic target.
|
Results and Discussion |
|---|
|
TopAbstractResults and DiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
); the S209 mutations target a conserved phosphorylation site for MNK1/2 kinases, with the serine-to-alanine (S209A) mutation abolishing phosphorylation and the serine-to-aspartic acid (S209D) mutation resembling phosphorylated eIF4E (Waskiewicz et al. 1997). These mutants were cloned into MSCV-IRES-GFP, and their expression verified in 3T3 cells following retroviral transduction (Supplementary Fig. 1A–C). All mutants were efficiently expressed, except W73A, which may be more prone to proteasomal degradation (Murata and Shimotohno 2006) (Supplementary Fig. 1C).
|
). Retroviruses encoding eIF4E or the various mutants were introduced into hematopoietic stem cells (HSCs) and used to reconstitute irradiated syngeneic recipients (Supplementary Fig. 2). These mice were monitored for lymphoma, and the tumor cells were analyzed for GFP expression.
As expected, wild-type eIF4E markedly accelerated tumor development (eIF4E vs. GFP: P < 0.0001) (Fig. 1B). By contrast, tumors arising from Eµ-Myc transgenic HSCs infected with the W56A or W73F alleles arose with a latency that resembled controls (W56A vs. GFP: P = 0.56; W73F vs. GFP: P = 0.46). Although only 
25% the initial stem/progenitor cells were infected (data not shown), lymphomas arising from eIF4E-expressing HSCs were invariably GFP positive (Fig. 1B,C). HSCs infected with the other vectors were infected at a similar efficiency, but only 0%–22% of the resulting tumors were GFP positive, indicating they were not advantageous in vivo (Fig. 1B,C). Since the W56A mutant is defective in cap-dependent translation, these data imply that this function is crucial for eIF4E-mediated oncogenesis. The data also suggest that the mRNA transport functions are dispensable, although it remains possible that the reduced expression of the W73F mutant (also seen for the W73A mutant) contributes to the defect (Supplementary Fig. 2C).
The most surprising results arose from mice reconstituted with cells expressing eIF4E mutants affecting the MNK1/2 phosphorylation site. Mice reconstituted with cells expressing the S209A mutant were defective at promoting tumorigenesis (S209A vs. GFP: P = 0.24); by contrast, mice reconstituted with cells expressing the phosphomimetic S209D mutant displayed accelerated tumor onset comparable with wild-type eIF4E (S209D vs. GFP: P < 0.0001) (Fig. 1B). Seventy-five percent of the tumors arising from HSCs transduced with the S209D mutant were GFP positive, while only 28% of HSCs infected with S209A gave rise to tumors expressing the GFP reporter (Fig. 1B). Apparently, eIF4E phosphorylation at S209 of is important for oncogenicity.
If eIF4E phosphorylation at Ser 209 is essential for oncogenesis, then constitutively activated MNK kinases might also be tumorigenic. We therefore examined the ability of an activated (T332D) or kinase-dead (T2A2) form of MNK1 (Waskiewicz et al. 1999) to promote tumorigenesis in the Eµ-Myc system. Like eIF4E, activated MNK1, but not the kinase-dead mutant, substantially accelerated lymphomagenesis (Mnk1 vs. GFP: P < 0.0001) (Fig. 2A), producing lymphomas with a mature B cell phenotype (Supplementary Table 1; Wendel et al. 2004). Both Mnk1- and eIF4E-expressing lymphomas showed low levels of apoptosis relative to most control tumors (Fig. 2B). Thus, MNK1 promotes tumor formation in a manner comparable with its substrate eIF4E.
|
; Schmitt et al. 2002), and genes that suppress apoptosis, like eIF4E, Akt, or Bcl-2 can prevent p53 loss in lymphomas derived from p53+/– cells (Schmitt et al. 2002; Wendel et al. 2004). The observation that activated MNK1 also produces rapid tumors with a low apoptotic rate suggests that eIF4E phosphorylation attenuates apoptosis. To test this, we introduced mutant forms of eIF4E or Mnk1 into Eµ-Myc/p53+/– HSCs and determined whether the resulting tumors retained the wild-type p53 allele. Here, only tumors expressing the S209D mutant or activated MNK1—but not those expressing S209A—retained the wild-type p53 allele (three out of three for eIF4E S209D, and two out of three Mnk1) (Fig. 2C).
In parallel, we tested the ability of activated (T332D) and dominant-negative (T2A2) MNK1 and different eIF4E mutants to oppose c-Myc-induced apoptosis in mouse embryo fibroblasts (MEFs) (Evan et al. 1992). MEFs coinfected with c-Myc and eIF4E, its S209D mutant, or activated Mnk1 were resistant to apoptosis; in contrast, cells expressing vector alone, Mnk (T2A2), or the S209A mutant alleles of eIF4E remained sensitive (Fig. 2D). Thus, the oncogenic function of Mnk1 and eIF4E correlates with their ability to attenuate apoptosis in vitro and in vivo.
Our results linking Mnk to oncogenesis are surprising given that mice deficient in Mnk kinase develop normally (Ueda et al. 2004). Next, we tested whether MNK inhibition would sensitize cells to apoptosis in vitro or inhibit tumor expansion in vivo. MEFs derived from Mnk1/2 double-knockout (DKO) mice were transduced with Myc and examined for viability after serum depletion (Evan et al. 1992). Mnk1/2 DKO MEFs expressing Myc were hypersensitized to apoptosis (Fig. 3A, P < 0.0001) in a manner was reversed by reintroduction of the activated Mnk1 allele (T332D). However, in contrast to wild-type cells, Mnk1/2 DKO cells overexpressing both eIF4E and the S209A mutant remained hypersensitive to apoptosis (Fig. 3B).
|
). A subset of tumor cells was transduced with a Mnk-expressing MSCV-IRES-GFP-based vector and the mixed population transplanted into recipient animals. In this assay, an increase or decrease in GFP indicates that cells expressing the transgene have a selective advantage or disadvantage compared with controls, respectively. The assay was performed in Eµ-Myc/Arf–/– and Eµ-Myc/Tsc2–/– tumor cells, since TSC2-null lymphomas activate the mTOR pathway and ARF-null lymphomas do not (A. Malina and J. Pelletier, unpubl.) (Wendel et al. 2006). The impact of Mnk inhibition was genotype dependent. The activated Mnk1 (T332D) conferred an advantage in vivo, and cells of either genotype expressing this mutant were enriched during tumor formation (Fig. 3C, top panels). By contrast, while the Mnk1 (T2A2) mutant had minimal effect in Arf–/– lymphoma cells, it dramatically inhibited the proliferation of Tsc2–/– cells, such that T2A2-expressing lymphoma cells were almost completely depleted from the population during lymphoma expansion (Fig. 3C, bottom panels). Thus, Mnk kinase inhibition appears to selectively inhibit tumor cells with deregulated translational control.
One potential anti-apoptotic target of phosphorylated eIF4E is Mcl-1, which is preferentially translated in some cancer cells with defects in RAS/PI3K signaling (Rajasekhar et al. 2003; Adams and Cooper 2007) and whose translation is reduced in human leukemia cells following pharmacologic inhibition of MAPK signaling (Rahmani et al. 2005). Accordingly, MNK1-expressing tumors expressed elevated levels of eIF4E phosphorylation and Mcl-1 protein (Fig. 4A). Acute expression of eIF4E and MNK1, but not eIF4E S209A, in MEFs also increased Mcl-1 protein levels (Fig. 4B), whereas the dominant-negative MNK1 (T2A2) had the opposite effect (Fig. 4C). The ability of eIF4E or MNK1 to increase Mcl-1 protein was partly due to translation, since cells expressing these genes contain more Mcl-1 mRNA in the polysome fraction compared with controls, which remained unchanged in total mRNA (Fig. 4D,E). Finally, MCL-1 dramatically accelerated lymphomagenesis in the Eµ-Myc model (Fig. 4F). While MCL-1 expression in the resulting tumors was significantly higher than those expressing eIF4E or Mnk1 (data not shown), these data collectively indicate that Mcl-1 is one target of phosphorylated eIF4E during oncogenesis.
|
|
; Scheper and Proud 2002). However, while eIF4E phosphorylation is dispensable for mouse development (Ueda et al. 2004), our studies indicate that it plays a crucial role during tumorigenesis. Thus, eIF4E’s oncogenic activity correlates with its ability to activate translation and become phosphorylated on Ser 20, and constitutively activated Mnk1, a Ser 209 kinase, promotes tumorigenesis in a manner similar to eIF4E. Furthermore, a dominant-negative MNK1 mutant prevents eIF4E phosphorylation and inhibits the proliferation of tumor cells driven by mutations that deregulate translation. Consistent with our findings, the S209A cannot transform NIH 3T3 cells in vitro (Topisirovic et al. 2004). Still, it is unlikely that the organismal role of eIF4E phosphorylation is to promote tumorigenesis, but perhaps instead acts to enhance translation under circumstances of proliferation or cell stress.
In the Eµ-Myc model, phosphorylated eIF4E appears to promote tumorigenesis mainly by suppressing apoptosis, although how this occurs at the biochemical level remains to be fully elucidated. Most, but not all, studies suggest that phosphorylation has a positive effect on cap-dependent translation (Scheper and Proud 2002). Mcl-1, which is encoded by a message containing a structured 5'UTR, is specifically affected by the state of eIF4E phosphorylation in our model. Accordingly, high levels of phosphorylated eIF4E and MCL-1 occur together in human lymphomas. Thus, while MCL-1 may be regulated at additional levels (Le Gouill et al. 2004), its enhanced translation likely contributes to eIF4E-mediated oncogenesis.
The roles of the MNK kinases have remained elusive owing to the lack of biological readouts for their activity and a phenotype in the knockout mice (Ueda et al. 2004). We see that a constitutively activated MNK1 can be a potent oncogene in vivo. Of note, the similar onset and pathology of Mnk1- and eIF4E-expressing tumors, the inability of the MNK target site eIF4E mutant (S209A) to be oncogenic, and the shared ability of eIF4E and activated MNK1 to up-regulate MCL-1 all suggest that the oncogenic impact of MNK kinases involves targeting eIF4E, although it remains possible that nontranslational targets also play a role. Although sporadic mutations in Mnk1 or Mnk2 have not been observed, our studies raise the possibility these enzymes may mediate oncogenic signals in human cancers.
The fact that eIF4E acts at a convergence point of two crucial signaling pathways altered in cancer cells makes it an intriguing therapeutic target. Although targeting the translation initiation apparatus might produce substantial toxicity, our observation that eIF4E phosphorylation is important for tumorigenesis and previous work suggesting that it is dispensable for organismal viability suggests that inhibiting this event would have selective anti-tumor activity. Consistent with this idea and extending it further, our limited analysis to date suggests that the anti-proliferative effects of MNK1 kinase inhibition are restricted to tumors with deregulated translational control. Interestingly, small molecule inhibitors of the MNK kinases have been produced but are not being developed and, in our hands, were unable to prevent MNK-induced phosphorylation of eIF4E in vivo (A. Malina and J. Pelletier, unpubl.). By contrast, inhibitors of mTOR are in clinical trials, although their activity is limited, in part, by activation of AKT/PKB through a feedback mechanism involving S6 kinase (Sun et al. 2005). Targeting eIF4E downstream from mTOR—for example, via inhibition of MNK kinases—might circumvent feedback activation and present a therapeutic alternative.
|
Materials and methods |
|---|
|
TopAbstractResults and DiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
Lymphomas were generated and analyzed as described (Schmitt et al. 2002). The retroviruses used to produce tumors were based on MSCV-IRES-GFP (MIG) and expressed cDNAs encoding the eIF4E mutants W56A, W73A, S209A, and S209D, and the Mnk alleles T332D and T2A2. p53 loss of heterozygosity (LOH) was determined by allele-specific PCR of FACS-purified tumor cells (Wendel et al. 2004). For competition experiments, short-term lymphoma cultures were transduced with GFP-expressing retroviral vectors and the mixed populations were transplanted by tail-vein injection into nontransgenic female C57BL/6 animals. Tumors were then harvested and GFP expression was determined by flow cytometry (Wendel et al. 2004).
Histopathology
Preparation of samples, H&E stain, and detection of antibody stains was described (Wendel et al. 2004). Antibodies were against phosphorylated ribosomal S6 protein (Cell Signaling #2215) and phosphorylated eIF4E (Cell Signaling #9714). TUNEL was performed using a published protocol (McCurrach and Lowe 2001).
TMA analysis
The study cohort comprised 77 DLBCL collected and diagnosed at first evaluation at MSKCC and approved by the MSKCC IRB. TMAs were constructed as described previously (Maeda et al. 2005) and stained with antibodies against phosphorylated eIF4E (Cell Signaling #9741, 1:10) and Mcl1 (Cell Signaling #4572, 1:250). Positivity was defined as at least 30% of tumor cells stained for the probed antigen.
Western blot analysis
Immunoblots were performed as described (Wendel et al. 2004) using antibodies against phosphorylated Mnk1 (Cell Signaling #2111, 1:1000), total and phosphorylated eIF4E (both 1:1000, Cell Signaling #9742 and #9741), total and phosphorylated ribosomal S6 (Cell Signaling #2215, 1:1000), Mcl-1 (Abcam, ab32087-100, 1:1000), Tubulin (Sigma, B-5-1-2, 1:5000), and anti-HA (Roche 12013819, 1:5000).
Flow cytometry
Tumor cell suspensions were stained with the indicated antibodies (PharMingen and CalTag) conjugated with phycoerythrin (PE), Tri-Color (TC), or biotin, developed with streptavidin–allophycocyanin (PharMingen) and analyzed with FACSCalibur (Becton Dickinson).
Cell culture and viability
Primary MEFs of wild-type and Mnk1/2 DKO were cultured and analyzed as described (McCurrach and Lowe 2001). For apoptosis assays, MEFs were transduced with pBabe-Myc, selected with puromcin, and subjected to serum withdrawal for 12–24 h; viability was determined by trypan blue stain.
Polysome fractionation
As described in detail in Xi et al. (2004), cells were treated with cycloheximide before harvesting and lysing. The nuclei were pelleted and the ribosomal components were separated from the soluble fraction by ultracentrifugation. RNA was isolated using Trizol (Invitrogen) and cDNA synthesis was performed using the SuperScript III kit (Invitrogen). RT–PCR primers were Mcl1F, AGCCTGACTTCCCAGCTCAC; Mcl1R, GCACTCAGACCACATGCTTC; ActinF, AAGCTAACCGGGAGAA GATG; and ActinR, GTAGTCAGTGAGGTCGCGAC.
|
Acknowledgments |
|---|
|
TopAbstractResults and DiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
|
Footnotes |
|---|
E-MAIL wendelh{at}mskcc.org; FAX (646) 422.0197. 
Article published online ahead of print. Article and publication date are online at http://www.genesdev.org/cgi/doi/10.1101/gad.1604407
|
References |
|---|
|
TopAbstractResults and DiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
Bilanges, B. and Stokoe, D. 2007. Mechanisms of translational deregulation in human tumors and therapeutic intervention strategies. Oncogene 26: 5973–5990.[CrossRef][Medline]
Dilling, M.B., Dias, P., Shapiro, D.N., Germain, G.S., Johnson, R.K., and Houghton, P.J. 1994. Rapamycin selectively inhibits the growth of childhood rhabdomyosarcoma cells through inhibition of signaling via the type I insulin-like growth factor receptor. Cancer Res. 54: 903–907.
Evan, G.I., Wyllie, A.H., Gilbert, C.S., Littlewood, T.D., Land, H., Brooks, M., Waters, C.M., Penn, L.Z., and Hancock, D.C. 1992. Induction of apoptosis in fibroblasts by c-myc protein. Cell 69: 119–128.[CrossRef][Medline]
Hay, N. and Sonenberg, N. 2004. Upstream and downstream of mTOR. Genes & Dev. 18: 1926–1945.
Lachance, P.E., Miron, M., Raught, B., Sonenberg, N., and Lasko, P. 2002. Phosphorylation of eukaryotic translation initiation factor 4E is critical for growth. Mol. Cell. Biol. 22: 1656–1663.
Lazaris-Karatzas, A., Montine, K.S., and Sonenberg, N. 1990. Malignant transformation by a eukaryotic initiation factor subunit that binds to mRNA 5' cap. Nature 345: 544–547.[CrossRef][Medline]
Le Gouill, S., Podar, K., Harousseau, J.L., and Anderson, K.C. 2004. Mcl-1 regulation and its role in multiple myeloma. Cell Cycle 3: 1259–1262.[Medline]
Maeda, T., Hobbs, R.M., Merghoub, T., Guernah, I., Zelent, A., Cordon-Cardo, C., Teruya-Feldstein, J., and Pandolfi, P.P. 2005. Role of the proto-oncogene Pokemon in cellular transformation and ARF repression. Nature 433: 278–285.[CrossRef][Medline]
Mamane, Y., Petroulakis, E., Martineau, Y., Sato, T.A., Larsson, O., Rajasekhar, V.K., and Sonenberg, N. 2007. Epigenetic activation of a subset of mRNAs by eIF4E explains its effects on cell proliferation. PLoS ONE 2: e242. doi: 10.1371/journal.pone.0000242.[CrossRef]
Marcotrigiano, J., Gingras, A.C., Sonenberg, N., and Burley, S.K. 1997. Cocrystal structure of the messenger RNA 5' cap-binding protein (eIF4E) bound to 7-methyl-GDP. Cell 89: 951–961.[CrossRef][Medline]
McCurrach, M.E. and Lowe, S.W. 2001. Methods for studying pro- and antiapoptotic genes in nonimmortal cells. Methods Cell Biol. 66: 197–227.[Medline]
Murata, T. and Shimotohno, K. 2006. Ubiquitination and proteasome-dependent degradation of human eukaryotic translation initiation factor 4E. J. Biol. Chem. 281: 20788–20800.
Polunovsky, V.A., Gingras, A.C., Sonenberg, N., Peterson, M., Tan, A., Rubins, J.B., Manivel, J.C., and Bitterman, P.B. 2000. Translational control of the antiapoptotic function of Ras. J. Biol. Chem. 275: 24776–24780.
Rahmani, M., Davis, E.M., Bauer, C., Dent, P., and Grant, S. 2005. Apoptosis induced by the kinase inhibitor BAY 43-9006 in human leukemia cells involves down-regulation of Mcl-1 through inhibition of translation. J. Biol. Chem. 280: 35217–35227.
Rajasekhar, V.K., Viale, A., Socci, N.D., Wiedmann, M., Hu, X., and Holland, E.C. 2003. Oncogenic Ras and Akt signaling contribute to glioblastoma formation by differential recruitment of existing mRNAs to polysomes. Mol. Cell 12: 889–901.[CrossRef][Medline]
Ruggero, D. and Pandolfi, P.P. 2003. Does the ribosome translate cancer? Nat. Rev. Cancer 3: 179–192.[CrossRef][Medline]
Ruggero, D., Montanaro, L., Ma, L., Xu, W., Londei, P., Cordon-Cardo, C., and Pandolfi, P.P. 2004. The translation factor eIF-4E promotes tumor formation and cooperates with c-Myc in lymphomagenesis. Nat. Med. 10: 484–486.[CrossRef][Medline]
Scheper, G.C. and Proud, C.G. 2002. Does phosphorylation of the cap-binding protein eIF4E play a role in translation initiation? Eur. J. Biochem. 269: 5350–5359.[Medline]
Schmitt, C.A., Fridman, J.S., Yang, M., Baranov, E., Hoffman, R.M., and Lowe, S.W. 2002. Dissecting p53 tumor suppressor functions in vivo. Cancer Cell 1: 289–298.[CrossRef][Medline]
Strasser, A., Harris, A.W., Bath, M.L., and Cory, S. 1990. Novel primitive lymphoid tumours induced in transgenic mice by cooperation between myc and bcl-2. Nature 348: 331–333.[CrossRef][Medline]
Sun, S.Y., Rosenberg, L.M., Wang, X., Zhou, Z., Yue, P., Fu, H., and Khuri, F.R. 2005. Activation of Akt and eIF4E survival pathways by rapamycin-mediated mammalian target of rapamycin inhibition. Cancer Res. 65: 7052–7058.
Topisirovic, I., Ruiz-Gutierrez, M., and Borden, K.L. 2004. Phosphorylation of the eukaryotic translation initiation factor eIF4E contributes to its transformation and mRNA transport activities. Cancer Res. 64: 8639–8642.
Ueda, T., Watanabe-Fukunaga, R., Fukuyama, H., Nagata, S., and Fukunaga, R. 2004. Mnk2 and Mnk1 are essential for constitutive and inducible phosphorylation of eukaryotic initiation factor 4E but not for cell growth or development. Mol. Cell. Biol. 24: 6539–6549.
Waskiewicz, A.J., Flynn, A., Proud, C.G., and Cooper, J.A. 1997. Mitogen-activated protein kinases activate the serine/threonine kinases Mnk1 and Mnk2. EMBO J. 16: 1909–1920.[CrossRef][Medline]
Waskiewicz, A.J., Johnson, J.C., Penn, B., Mahalingam, M., Kimball, S.R., and Cooper, J.A. 1999. Phosphorylation of the cap-binding protein eukaryotic translation initiation factor 4E by protein kinase Mnk1 in vivo. Mol. Cell. Biol. 19: 1871–1880.
Wendel, H.G., De Stanchina, E., Fridman, J.S., Malina, A., Ray, S., Kogan, S., Cordon-Cardo, C., Pelletier, J., and Lowe, S.W. 2004. Survival signalling by Akt and eIF4E in oncogenesis and cancer therapy. Nature 428: 332–337.[CrossRef][Medline]
Wendel, H.G., Malina, A., Zhao, Z., Zender, L., Kogan, S.C., Cordon-Cardo, C., Pelletier, J., and Lowe, S.W. 2006. Determinants of sensitivity and resistance to rapamycin-chemotherapy drug combinations in vivo. Cancer Res. 66: 7639–7646.
Xi, Q., Cuesta, R., and Schneider, R.J. 2004. Tethering of eIF4G to adenoviral mRNAs by viral 100k protein drives ribosome shunting. Genes & Dev. 18: 1997–2009.
CiteULike 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  K. J. Mavrakis, H. Zhu, R. L.A. Silva, J. R. Mills, J. Teruya-Feldstein, S. W. Lowe, W. Tam, J. Pelletier, and H.-G. Wendel Tumorigenic activity and therapeutic inhibition of Rheb GTPase Genes & Dev., August 15, 2008; 22(16): 2178 - 2188. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. R. Mills, Y. Hippo, F. Robert, S. M. H. Chen, A. Malina, C.-J. Lin, U. Trojahn, H.-G. Wendel, A. Charest, R. T. Bronson, et al. mTORC1 promotes survival through translational control of Mcl-1 PNAS, August 5, 2008; 105(31): 10853 - 10858. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Culjkovic, K. Tan, S. Orolicki, A. Amri, S. Meloche, and K. L.B. Borden The eIF4E RNA regulon promotes the Akt signaling pathway J. Cell Biol., April 3, 2008; 181(1): 51 - 63. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
