![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
to chromatin for initiation of DNA replication1 Department of Biochemistry and Molecular Genetics, University of Virginia School of Medicine, Charlottesville, Virginia 22908, USA; 2 Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, North Carolina 27710, USA
 |
Abstract |
|---|
 Top Abstract ResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
(pol ), is brought to the origins is still unclear. We show that And-1/Ctf4 (Chromosome transmission fidelity 4) interacts with Mcm10, which associates with MCM2-7, and with the p180 subunit of DNA pol . And-1 is essential for DNA synthesis and the stability of p180 in mammalian cells. In Xenopus egg extracts And-1 is loaded on the chromatin after Mcm10, concurrently with DNA pol , and is required for efficient DNA synthesis. Mcm10 is required for chromatin loading of And-1 and an antibody that disrupts the Mcm10–And-1 interaction interferes with the loading of And-1 and of pol , inhibiting DNA synthesis. And-1/Ctf4 is therefore a new replication initiation factor that brings together the MCM2-7 helicase and the DNA pol –primase complex, analogous to the linker between helicase and primase or helicase and polymerase that is seen in the bacterial replication machinery. The discovery also adds to the connection between replication initiation and sister chromatid cohesion.
[Keywords: And-1/CTF4; DNA replication; genome stability; cell cycle; DNA polymerase]
Received June 21, 2007; revised version accepted July 24, 2007.
). Following this, the activation of Cdc7/Dbf4 and Cdk2/Cyclin E protein kinases leads to the melting of origin DNA and initiation of DNA replication. MCM2-7 interacts with and is required to load Mcm10, which is itself critical for the loading of replication elongation factors like Cdc45 (Aparicio et al. 1997), GINS, and DNA polymerase (pol ) (Mimura and Takisawa 1998; Takayama et al. 2003; Ricke and Bielinsky 2004; Gambus et al. 2006; Pacek et al. 2006). The loading of Mcm10 at replication origins precedes and is necessary for later loading of Replication Protein A (RPA) and DNA pol onto replication origins. However, how the initiator primase–polymerase complex, DNA pol , is brought to the origins is unclear.
Once DNA replication initiates, MCM2-7, Cdc45, Mcm10, and GINS proteins migrate with the replication fork along with DNA pol and other replicative polymerases. In many bacteriophages the DNA helicase and the primase are part of the same molecule, while in bacteria, the helicase, DnaB and the primase, DnaG are in direct contact with each other (Soultanas 2005). In addition, a linker protein, the 
subunit, tethers the bacterial helicase DnaB to the catalytic subunits of the replicative polymerase (McHenry 2003; Bell 2006). Similarly in SV40, the helicase T antigen interacts directly with the replicative polymerase–primase, DNA pol (Dornreiter et al. 1992; Huang et al. 1998). An analogous link is expected in the eukaryotic cellular replisome between the primase-containing DNA pol and the MCM2-7 helicase, but such a linker has not yet been found.
Ctf4 (Chromosome transmission fidelity 4) in Saccharomyces cerevesiae was originally identified in a genetic screen for mutants affecting chromosome transmission fidelity (Kouprina et al. 1992). Later studies indicate that Ctf4 is required for sister chromatid cohesion (Hanna et al. 2001; Mayer et al. 2004; Petronczki et al. 2004), but the mechanism for this is unclear. Ctf4 was found to interact with DNA pol in yeasts (Miles and Formosa 1992b; Zhou and Wang 2004). Although it is not essential for viability in budding yeast, mcl1, the homolog of CTF4 in Schizosaccharomyces pombe, is essential for viability, maintenance of genome integrity, DNA damage repair, and regulation of telomere replication (Williams and McIntosh 2002; Tsutsui et al. 2005). The Aspergillus nidulans homolog of CTF4, SepB, is also essential for viability (Harris and Hamer 1995). Mcl1/Ctf4 exhibits genetic interaction with genes involved in lagging strand DNA synthesis such as Rad2, Dna2, and Fen1 and physically interacts with DNA pol (Formosa and Nittis 1999; Tsutsui et al. 2005), but its exact role in DNA replication has not yet been defined. The human homolog of Ctf4, And-1, was also identified and its function too is unknown (Kohler et al. 1997).
In this study we report that And-1/Ctf4/Mcl1 interacts with both Mcm10 and DNA pol . The Mcm10–And-1 interaction is required for the loading of DNA pol on chromatin and for DNA synthesis. DNA replication initiation factors were shown before to be linked to sister chromatid cohesion (Gillespie and Hirano 2004; Takahashi et al. 2004). Therefore, the implication of And-1/Ctf4 in replication initiation suggests a reason why it might be required for sister chromatid cohesion. The results explain how a crucial factor in the elongation machinery, the DNA polymerase–primase, is recruited to the initiation machinery at origins of replication, and begin to define the physical complex of proteins that is expected to tether the replicative helicase, MCM2-7 to the replicative polymerase–primase.
|
Results |
|---|
|
TopAbstractResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
An antibody against full length of Mcm10 specifically immunoblotted and immunoprecipitated the 110-kDa Mcm10 protein from cell lysates (Fig. 1, lanes 4,6). Upon immunoprecipitation of Mcm10 from cells metabolically labeled with [35S]methionine, at least seven proteins of 30–170 kDa were detected in the Mcm10 precipitates (Fig. 1B, lane 2). Denaturation of cell lysates by boiling in 1% SDS resulted in only the 110-kDa Mcm10 protein being immunoprecipitated (Fig. 1B, lane 4), suggesting that the extra proteins in the native immunoprecipitate were brought down through noncovalent interactions with native Mcm10. Peptide sequences to Mcm10, Mcm6, and Mcm7 were identified when the protein bands in the nondenatured Mcm10 immunoprecipitate were excised and subjected to mass spectroscopy (Supplementary Table S1). Consistent with this, immunoblotting with a panMCM2-7 antibody detected five bands of 85–120 kDa in the Mcm10 immunoprecipitates (Supplementary Fig. S1; Supplementary Table S1), confirming previous reports that Mcm10 interacted with the MCM2-7 complex (Kawasaki et al. 2000; Lei et al. 2002).
|
), indicating that And-1 may play a role in the DNA replication. To test this interaction, we raised an antibody against fragment (776–927) of And-1. Mcm10 was detected in the And-1 immunoprecipitates (Fig. 1C, top, lane 3) and And-1 was detected in the Mcm10 immunoprecipitate (Fig. 1C, top, lane 5). When Myc-Mcm10 and GST-And-1 were expressed by transient transfection of human 293T cells, Myc-Mcm10 coimmunoprecipitated with GST-And-1 and vice-versa (Fig. 1C, bottom). Thus, endogenous or transfected Mcm10 physically associates with endogenous or transfected And-1.
To determine when in the cell cycle And-1 interacts with Mcm10, U2OS osteosarcoma cells were synchronized in early S phase by thymidine/aphidicolin block and released (Fig. 1D). And-1 levels remained stable throughout the cell cycle, while Mcm10 protein levels fluctuated with an increase in S phase (Fig. 1D), as has been previously described (Izumi et al. 2001, 2004). The And-1 content of Mcm10 immunoprecipitates closely parallels the cellular levels of Mcm10, with the most abundant coimmunoprecipitation occurring in S phase when Mcm10 is most abundant (Fig. 1D, cf. lanes 1–4 and 7). We also examined the localization of both Mcm10 and And-1 in the S phase by immunostaining. Mcm10 and And-1 colocalized in nuclei changing from a fine granular immunofluorescence pattern in early S-phase cells to a coarse clumpy pattern in late S-phase cells (Fig. 1E). In summary, mammalian And-1 and Mcm10 associate with each other and colocalize in S phase.
Both Mcm10 and And-1 interact with DNA pol p180
The budding yeast homolog of And-1, Ctf4, and Mcm10 interact with DNA pol (Miles and Formosa 1992a, b; Ricke and Bielinsky 2004). To test whether the same was true in human cells, endogenous And-1 and Mcm10 were immunoprecipitated from cell lysates. Endogenous p180 can be detected in both And-1 and Mcm10 immunoprecipitates (Fig. 2A). From the analysis of the immunoblots, a very small percent of human pol p180 coimmunoprecipitates with human And-1 and Mcm10, respectively, most likely reflecting the lability of these interactions in solution and post-lysis. Upon transient expression of Flag-And-1 in 293T cells, the p180 subunit of endogenous DNA pol was detected in Flag-And-1 immunoprecipitates (Fig. 2B, lane 3). Endogenous p180 was also detected in Myc-Mcm10 immunoprecipitates (Fig. 2B, lane 7). Therefore, human And-1 forms a complex with Mcm10 and Pol . The coimmunoprecipitation persisted in ethidium bromide or after DNase treatment, suggesting that DNA bridges were not involved in the coimmunoprecipitation. Whether And-1–Mcm10 and pol form a ternary complex needs to be further investigated.
|
p180. And-1 contains three major domains: a WD40 repeat-containing domain at the N terminus, a SepB homology domain in the middle, and an HMG domain at the C terminus (Fig. 2C, top). Full-length And-1 and And-1 (330–1129) interact with p180 and Mcm10, and And-1 (1–336) does not, indicating that the N-terminal WD40 domain is dispensable for the interaction with p180 or Mcm10 (Fig. 2C). The extreme C terminus of And-1 (984–1129), however, is not sufficient for interaction with p180 or Mcm10.
And-1 is required for efficient DNA replication
Given that And-1 complexes with Mcm10 and Pol , we next tested whether And-1, like Mcm10 and Pol , is involved in DNA replication. Two separate small interfering RNA (siRNA) duplexes were designed to silence the expression of And-1 in HCT116 colon cancer cells (Figs. 2D, 3A, lanes 2,3). Propidium-iodide staining showed that depletion of And-1 increased the percent of cells between G1 and G2 peaks in the S-phase fraction (Fig. 2D, middle panel). To establish whether the And-1-depleted cells were in active DNA synthesis, they were labeled with Bromodeoxyuridine (BrdU) for 1 h before harvest. The incorporation of BrdU was monitored by two-color flow cytometry analysis of propidium-iodide-stained cells that were immunostained by anti-BrdU-FITC antibodies. As shown in Figure 2D (bottom panel), depletion of And-1 caused a fivefold decrease in the percentage of cells incorporating BrdU. Intriguingly, the And-1-depleted cells were not arrested in G1 or G2, but accumulated with arrested BrdU incorporation in early, middle, and late S phase (as judged from the propidium-iodide stain intensity), suggesting that And-1 may be critical for initiation events not only at early firing origins, but also initiation at late firing origins and/or for the elongation phase of DNA replication.
|
(p180) in human cells
An intriguing result came to light when we silenced And-1 in HCT116 cells and examined the protein levels of Mcm10, And-1, or the p180 subunit of DNA pol . p180 was markedly reduced in cells when And-1 was depleted (Fig. 3A [lanes 2,3], B). We noticed that a 120-kDa polypeptide reacting to the anti-p180 increased as p180 decreased, and may be a transient product of proteolysis of p180 (Fig. 3B). Pol p180 normally forms a pol –primase complex with three subunits, p70, p58, and p49. Unlike p180, the other subunits of pol were not markedly decreased by And-1 depletion, although p49 is decreased a little (Fig. 3C). Decreased p180 protein levels in And-1-depleted cells suggest that And-1 either stabilizes p180 by forming a complex with it or regulates expression of pol at the mRNA level. To distinguish between these two possibilities, we examined the mRNA level of pol (p180) in And-1-depleted cells. As shown in Figure 3D, the mRNA level of p180 was not affected by the absence of And-1, suggesting that p180 is down-regulated at a post-transcriptional level. In budding yeast, p180 is degraded in cells when Mcm10 is depleted (Ricke and Bielinsky 2004). It appears that the function of stabilizing p180 has evolved in mammalian cells from Mcm10 to a partner of Mcm10, And-1 (Fig. 3A, lanes 2–5). Collectively, these results suggest that And-1 is required to stabilize the p180 subunit of pol in human somatic cells.
To rule out off-target activities of the And-1 siRNA duplexes, we designed a third siRNA oligo And-1–3 targeting the N-terminal part of And-1. And-1–3 knocks down endogenous full-length And-1, but not a transiently expressed exogenous And-1 (330–1129), which interacts with pol p180 (Figs. 2C, 3E). Again, p180 protein was degraded in And-1-depleted and vector-transfected cells (Fig. 3E, lane 2). However, the decrease of p180 after transfection of And-1–3 was rescued by the expression of exogenous And-1 (330–1129) (Fig. 3E, lane 4), indicating that the destabilization of p180 was specifically due to loss of And-1.
And-1 is required for efficient DNA replication in Xenopus egg extracts
The requirement of And-1 for stabilizing p180 in mammalian cells complicated efforts to test whether And-1 recruits p180 to the chromatin. We therefore switched to the Xenopus egg system to test the functional relationship between XAnd-1 and pol . An antibody against the C-terminal part of Xenopus And-1 specifically recognized XAnd-1 in Xenopus egg extracts and human And-1 in 293T cell lysates (Fig. 4A, left panel). The anti-XAnd-1 serum depleted XAnd-1 protein from egg extracts without depleting Mcm10 or p180 (Fig. 4B). Extracts depleted of XAnd-1 exhibited a significant decrease in DNA replication compared with mock-depleted extracts (Fig. 4C). And-1 depletion inhibited the initial velocity of DNA synthesis to 40% of that in prebleed-depleted extracts (Fig. 4D). To confirm that this deficit was solely due to the removal of XAnd-1, we expressed recombinant human His-And-1 from a baculovirus in insect Sf9 cells. The purified recombinant human And-1 protein was stained by Coomassie and its identity confirmed by immunoblotting (Fig. 4A right panel). The DNA replication defect of And-1-depleted extracts was completely reversed by addition of recombinant human And-1 (Fig. 4E). Therefore, And-1 itself is required for DNA replication in egg extracts and the effect is not due to codepletion of And-1-associated proteins (Fig. 4B).
|
XAnd-1 binds to chromatin after pre-RC assembly in a Cdk2 activity-dependent manner
To gain mechanistic insight into how And-1 is involved in DNA replication, we examined the chromatin loading of And-1 during DNA replication. In an unperturbed Xenopus egg extract, Orc2 and Mcm7 are already bound to sperm chromatin by 15 min (Fig. 4G), consistent with their role in pre-RC assembly. Mcm10 binds soon after, while And-1, Cdc45, and pol bind to chromatin simultaneously and with slower kinetics than Mcm10. RPA and PCNA also bind to chromatin with kinetics similar to that of And-1. These results suggest that And-1, unlike MCM2-7 and ORC, is not a component of the pre-RC for licensing. Instead, And-1 is loaded at a step after Mcm10 binding at about the time that the pre-RC changes to an active replication fork. Consistent with this, inhibition of cdk2 kinase by addition of the cdk inhibitor GST-p21N (Chen et al. 1995) to the egg extracts blocked the loading of And-1 and Cdc45 to chromatin (Fig. 4H). Under these conditions, the nuclear envelope formation was not affected (Supplementary Figs. S3, S4). Thus, And-1 loads onto the chromatin after pre-RC formation, after Mcm10 loading, and after cdk2 activation, at or soon after the origin-unwinding step.
And-1 is not a cofactor of DNA polymerase
The inhibition in DNA replication after depletion of XAnd-1 from the Xenopus egg extracts could be explained if And-1 is a cofactor of DNA polymerase complex. To test this, origin-independent DNA synthesis was assessed in Xenopus egg extracts using M13 single-strand DNA as substrate. Within 30 min, M13 DNA was replicated in the extracts, and this was completely inhibited after addition of aphidicolin, an inhibitor of DNA pol (Fig. 5A). The depletion of XAnd-1 from the extracts did not have any effect on M13 single-strand DNA replication as compared with control (Fig. 5B, Prebleed) depletion, suggesting that And-1 is not a cofactor of DNA pol complex.
|
Given that XMcm10 binds to chromatin before XAnd-1, and XMcm10 interacts with XAnd-1, we hypothesized that XMcm10 is required for loading of XAnd-1 onto origins for DNA replication initiation. XMcm10 was immunodepleted from the egg extracts to test its requirement for the chromatin loading of various factors during the replication reaction (Fig. 5C). Although XAnd-1 was not codepleted from the egg extracts (Fig. 5C, lane 2), the depletion of XMcm10 blocked the loading of And-1 and Cdc45 on chromatin (Fig. 5C, lanes 7–10) and not that of the pre-RC components. Thus, XMcm10 is required to load XAnd-1 on chromatin. It is worth noting here that although XMcm10 coimmunoprecipitates with XAnd-1 (Fig. 6A, lane 3), the interaction is labile and egg extracts are highly enriched in replication factors, so that it is not surprising that there is an excess of free XAnd-1 in the extract after XMcm10 depletion.
|
Next, we looked at loading of various DNA replication proteins in XAnd-1-depleted extracts and found that as compared with control depleted extracts, there was a significant delay in loading of DNA pol (p180) (Fig. 5D). Given that XMcm10 is required for loading of XAnd-1 onto chromatin, we hypothesized that the interaction between XAnd-1 and XMcm10 is important for loading of XAnd-1 and p180 onto chromatin. We noted that, although XAnd-1 can be detected in XMcm10 immunoprecipitates, immunoprecipitation of XAnd-1 by the antibody to the C-terminal part of And-1 fails to coimmunoprecipitate Mcm10 (Fig. 6A, lane 5). This result can be explained if the epitope recognized by the anti-XAnd-1 antibody is necessary for And-1–Mcm10 interaction. To confirm this, we tested whether the anti-XAnd-1 disrupts the interaction of human And-1 with Mcm10. Anti-XAnd-1 antibody was added to lysates from 293T cells in which Flag-And-1 is transiently transfected. Anti-XAnd-1 antibody inhibited the coimmunoprecipitation of Mcm10 with Flag-And-1 at 1.6% v/v (Fig. 6B, lanes 9,10), suggesting that the C-terminal epitope on And-1 recognized by the anti-And-1 antibody is indeed important for interaction with Mcm10.
We could therefore use the anti-XAnd-1 to interrupt the And-1–Mcm10 interaction and thus test the importance of the interaction in DNA replication. Addition of XAnd-1 antibody to the egg extract (5% v/v) suppressed DNA replication (Fig. 6C), while adding back recombinant His-hAnd-1 together with anti-XAnd-1 rescued both the DNA replication in egg extracts and the loading of DNA polymerase on to chromatin (Fig. 6C,D). To ascertain the step in the replication initiation process that is disrupted by the anti-XAnd-1 antibody, the chromatin association of replication factors was studied (Fig. 6E). Just as with depletion of Mcm10, addition of the antibody that disrupts Mcm10–And-1 interaction impairs the loading of And-1 on chromatin (Fig. 6E, right panel). Chromatin loading of Orc2, Mcm7, Mcm10, and Cdc45 is not impaired (Fig. 6E), consistent with the possibility that the antibody disrupts And-1 loading at a step after Mcm10 loading. Most important, the anti-XAnd-1 antibody also inhibits chromatin loading of p180 (Fig. 6E) without affecting the level of p180 in the extracts (Fig. 6F), suggesting that And-1 on the chromatin facilitates the stable association of p180 with chromatin. Consistent with this, immunodepletion of XAnd-1 significantly delayed the loading of p180 without decreasing or changing the kinetics of the association of Cdc45 or Mcm10 (Fig. 5D). The partial effect of And-1 immunodepletion (Figs. 4C, 5C) compared with the more dramatic effect of And-1 immunoneutralization (Fig. 6C,E) is most likely due to the partial depletion of XAnd-1 with the antibody (see Materials and Methods). These results are consistent with the proposal that the Mcm10–And-1 interaction is necessary for the loading of And-1 on chromatin, with the latter being required for the loading of DNA pol on chromatin.
|
Discussion |
|---|
|
TopAbstractResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
, a function that, in budding yeast, is carried out by Mcm10 itself. Fortunately, And-1 is not required for the stabilization of p180 in Xenopus egg extracts, allowing us to test whether And-1 is also required for the loading of p180 on chromatin. Such small regulatory differences between Xenopus egg extracts and human somatic cells have been seen before (for example, in the degradation of Cdt1) (Arias and Walter 2006; Senga et al. 2006) and are often very useful for mechanistic studies.
We found that XMcm10 is required for chromatin loading of XAnd-1, which itself facilitates the loading of DNA pol onto chromatin (Fig. 7). Mcm1 0 interacts with MCM2-7, and here we show that Mcm10 interacts with And-1 and DNA pol . And-1 and Mcm10 could therefore recruit Pol to the MCM2-7 loaded at origins of replication (Fig. 7), although it is not clear that MCM2-7–Mcm10–And-1–p180 form a ternary complex. Cdc45 has been shown to play a role in recruiting pol (Mimura and Takisawa 1998), but is not sufficient to recruit p180 when And-1 is absent from the chromatin (Fig. 6E). Like And-1, the loading of Cdc45 on chromatin requires cdk2 kinase activity and the presence of Mcm10. Together, these results suggest that Cdc45, Mcm10, and And-1 cooperate in the loading of DNA pol on chromatin.
|
, but such a critical role of Ctf4 in DNA replication was unsuspected. Our results demonstrate that Ctf4/And-1 is required for maintaining the stability of pol (in mammalian cells) and facilitates the loading of the polymerase at origins of replication. An additional role of Ctf4 in replication forks is possible based on the following evidence: (1) Deletion of CTF4 in cdc17-1 ts mutants decreases the maximum permissive temperature (Wittmeyer and Formosa 1997). CDC17 codes for the p180 homolog in S. cerevisiae. (2) As an essential gene in S. pombe, mcl1 ts mutants exhibit double-stranded breaks at the restrictive temperature (Tsutsui et al. 2005). (3) Ctf4 is part of the complex of proteins at a replication fork (Gambus et al. 2006; Lengronne et al. 2006). Thus, although we specifically examined the initiation stage of DNA replication, it is entirely possible that And-1 also helps maintain pol on chromatin near the elongation complex at the replication fork. Such a role in elongation would be consistent with the observations that And-1 is required late in S phase (Fig. 2D) and that Mcm10, p180, and Ctf4 are components of the replication fork. The fate of elongating vertebrate replication complexes after rapid inactivation of And-1/Ctf4 is necessary to critically evaluate this model.
The replicative polymerase in Escherichia coli, Pol III holoenzyme, is composed of many subunits individually required for DNA replication. Proteins executing similar functions as the Pol III subunits also exist in eukaryotes, but are rearranged as individual proteins or as complexes that are purified independently of the eukaryotic polymerases. Thus, the 
2 subunits of E. coli are ring-shaped clamps that retain the polymerase on the DNA template, but the function of the subunit is taken over by PCNA in eukaryotes (Kong et al. 1992; Krishna et al. 1994). Similarly, the 
–
complex in E. coli is the ATP-dependent clamp loader whose function is carried out in eukaryotes by RF-C (Jeruzalmi et al. 2001; Bowman et al. 2004). The subunit of the Pol III holoenzyme has one part that is closely related to the subunit of the – complex and another part that is unique. The unique part gives the subunit several critical functions (McHenry 2003). The subunit interacts with the dnaB helicase, stimulates its processivity, and links the helicase to the polymerase (Kim et al. 1996). In addition, direct physical contact is required between the dnaB helicase and the dnaG primase for DNA replication (Soultanas 2005). Similar protein links between the eukaryotic MCM2-7 helicase and the DNA polymerase–primase complex have not yet been discovered. We speculate that Mcm10 and And-1 form part of the complex that interacts both with MCM2-7 and with DNA pol , most likely in cooperation with GINS and Cdc45. The GINS complex in yeast interacts with Ctf4 (Gambus et al. 2006). Xenopus Mcm10, GINS, and Cdc45 are present in the replisome with the helicase and the polymerase, but experimental separation of the unwindosome from the polymerase reveals that GINS and Cdc45 partition with the MCM2-7 helicase in the unwindosome, while Mcm10 is lost from the unwindosome (Pacek et al. 2006). Thus, the bridge between the helicase MCM2-7 and the polymerase at the replication fork is likely to contain Cdc45 and GINS on the helicase side and Mcm10 and And-1 on the polymerase side, with multipartite protein–protein interactions stabilizing the complex. Physical interaction between dnaB and dnaG in bacteria keeps the lagging strand polymerase at the replication fork poised to synthesize the next Okazaki fragment (Soultanas 2005). The other possibility, therefore, is that And-1–Mcm10, Cdc45, and GINS serve to keep the lagging strand polymerase–primase complex, DNA pol , at the replication fork so that it can cycle from one Okazaki fragment to the next.
CTF4 was initially identified in a genetic screen for yeast mutants affecting chromosome transmission fidelity (Kouprina et al. 1992). The essential role of And-1 in pol function in mammals and Xenopus reported here agrees with the essential functions of Mcl1 and SepB (Harris and Hamer 1995; Williams and McIntosh 2002), but contradicts with the viability of S. cerevisiae lacking Ctf4. We speculate that a more stable Mcm10–p180 interaction in S. cerevisiae and the existence of other interactions involving Mcm10, Cdc45, and GINS in the bridge between the helicase and the polymerase explains why S. cerevisiae CTF4 is nonessential. S. cerevisiae Mcm10 protein is known to directly interact with p180 of DNA pol and is required for the stability of the p180 (Ricke and Bielinsky 2004). A similar role of Mcm10 in human cells could not be seen in our experiments, suggesting that vertebrate cells use the Mcm10 partner, And-1, to maintain the stability of DNA pol . Since Ctf4 moves with the replication fork in budding yeast (Gambus et al. 2006), it could, however, play a role in optimizing the association of the polymerase with initiator and elongation proteins in S. cerevisiae without being essential.
Chromosome missegregation and defects in sister-chromatid cohesion are noted in S. cerevisiae with mutations in CTF4. In vertebrates, the loading of cohesins on chromatin is dependent on the loading of MCM2-7 proteins in late mitosis/early G1 (Gillespie and Hirano 2004; Takahashi et al. 2004), well before the step when Ctf4/And-1 is loaded on chromatin. In yeast, preRC components are not even required for loading cohesins. There is a second step, however, where the already loaded cohesin rings are activated to grasp the sister chromatids as the replication fork passes through a chromosomal segment (Blow and Tanaka 2005; Lengronne et al. 2006). Thus, a likely explanation of the cohesion defect in ctf4 yeast may lie in a defective function of DNA polymerase at a yeast replication fork lacking Ctf4, leading to a defect in the activation of cohesion.
The role of And-1 in DNA replication initiation ties together several disparate phenomena noted in the field for more than a decade: (1) Ctf4 is involved in chromosome transmission fidelity. (2) Ctf4 physically and genetically interacts with DNA pol . (3) Ctf4/Mcl1 shows genetic interaction with proteins involved in lagging stand synthesis. (4) Mcm10 is required at origins of replication for the loading of DNA pol . Our results suggest that And-1 acts at a critical step downstream from Mcm10: It interacts with Mcm10 and is required for the proper loading of DNA pol and replication initiation. Most likely, the interaction persists as MCM2-7, Mcm10, And-1, and DNA pol leave the origin of replication as part of the replication fork. The results also shed light on an important and unexplained question: How does the initiation machinery ending with the loading of Mcm2-7 succeed in bringing components of the elongation machinery (starting with the DNA polymerase–primase) to origins of replication?
|
Materials and methods |
|---|
|
TopAbstractResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
293T and U2OS were grown in DMEM medium supplemented with 10% heat-inactivated donor calf serum and antibiotics. HCT116 cells were grown in McCoy’s medium supplemented with 10% heat-inactivated donor calf serum. Flow cytometry analysis was performed as described previously (Zhu et al. 2004).
Cloning and protein expression
GST-tagged And-1 was constructed as follows: The cDNA encoding the entire ORF from amino acids 1–1129 was PCR-amplified using primers containing BamHI and NotI sites, digested with BamHI and NotI, and ligated to pEBG digested with BamHI and NotI. The same sequence of And-1 was also cloned into pEFF vector digested with BamHI and NotI to produce Flag-tagged And-1. Fragments of And-1 encoding amino acids 1–336, 330–1129, and 984–1129 were cloned into pEFF for the expression of truncated Flag-tagged And-1 mutants using the same digestion sites. All of the truncated mutants have either an added NLS (nuclear localization sequence) or a native NLS. Nuclear localization of the truncation mutants was confirmed by immunofluorescence.
Full-length human And-1 was cloned into baculovirus by using a Bac-To-Bac Baculovirus expression system (Invitrogen). His-tagged And-1 protein was expressed in SF9 insect cells and lysed in 50 mM Tris (pH 7.7), 150 mM KCl, 0.1% Triton-X 100, and protease inhibitor. The soluble lysate was mixed with Ni-NTA agarose for 3 h. Beads were washed three times with 50 mM Tris (pH 7.7) and 300 mM KCl. His-And-1 was eluted from the beads with elution buffer 50 mM Tris (pH 7.7), 300 mM KCl, and 250 mM imidazole. The elution buffer was exchanged for the protein storage buffer (50 mM Tris at pH 7.7, 100 mM KCl, 10% glycerol) using the QuickChange PD10 column.
GST and GST-p21N were expressed and purified as described (Chen et al. 1995).
Antibodies and siRNA oligonucleotides
Mcm10, hAnd-1, and XAnd-1 antibodies were generated as follows: Full-length hMcm10 or a fragment of representing amino acids 776–927 of hAnd-1 (450-base-pair EcoR1 fragment of clone 4523768 from Invitrogen) were subcloned into pET 28a vector. The recombinant his-tagged products were purified by nickel affinity isolation and used as immunogens to generate antibodies in rabbits. Anti-XAnd-1 antibody was raised against a synthetic peptide (KPLGQSANNKLSAFAFKKE) of XAnd-1 (Open Biosystems).
Antibodies to Cdk2 (M2), pol (G-16), GST (z-5), and myc (9E10) were obtained from Santa Cruz Biotechnology. Anti-Flag antibody was obtained from Sigma. Pan MCM2-7 antibody AS.1 was from Dr. Stephen Bell (Massachussetts Institute of Technology, Cambridge, MA); anti-XOrc2, anti-XCdc45, anti-XMcm7, and anti-XMcm10 were from Dr. Johannes Walter (Harvard Medical School, Boston, MA); and antibodies to the subunits of pol were from Dr. Teresa Wang (Stanford University, Stanford, CA). Anti-BrdU antibody was from Pharmingen.
siRNA oligonucleotides were made to the following target sequences (sense): And-1-1 (AAGATGGTCAAGAAGGCA GCA), And-1-2 (AAGCAGGCATCTGCAGCATCC), and And-1-3 (TGACTCGCTTCACTACAAA). Mcm10-1 (AAGCCTT CTCTGGTCTGCGGC), Mcm10-2 (AAGCCCATAAGCTTT GCCTGC), and control GL2 were as described earlier (Zhu et al. 2004). siRNA transfections were performed twice with 100 nM siRNA oligonucleotide duplexes using Oligofectamine (Invitrogen) according to the manufacturer’s instructions. Cells were harvested for analysis 72 h after first transfection.
Xenopus DNA replication and chromatin-binding assays
Xenopus replication assay was performed as described elsewhere (Saxena et al. 2004) with slight modification. Briefly, BrdU was used instead of [P32]ATP and the amounts of BrdU incorporated were determined by ELISA. For replication assay with addition of antibody, Xenopus egg cytosols (10 µL) were incubated with 0.5 µL of anti-XAnd-1 antibody (and 400 ng of recombinant h-And-1 where indicated), followed by the addition of sperm chromatin and BrdU. The reaction mixtures were incubated for 90 min at 23°C before adding stop buffer. Chromatin-binding assay was performed following the method as described (Pacek and Walter 2004), with one minor modification. The extracts containing sperm chromatin (up to 15 µL) were diluted with 60 µL of cold ELB/NP-40 buffer (0.25 M sucrose, 2.5 mM MgCl2, 50 mM KCl, 10 mM HEPES at pH 7.5, 0.1% NP-40), layered onto a 180-µL sucrose cushion (ELB containing 0.5 M sucrose) in Beckman 5 x 44-mm microcentrifuge tubes and centrifuged as described (Pacek and Walter 2004).
Immunodepletion
To deplete protein in egg cytosol, 0.2 vol of antibody-bound protein A-sepharose (Pharmacia) was incubated with egg extracts for 1 h (three times) at 4°C for XAnd-1, and for 1 h (two times) at 4°C for XMcm10. The sensitivity of the anti-XAnd-1 antibody in immunoblots was such that we can say that XAnd-1 was depleted to <10% wild-type levels, but cannot say that we had depleted to <1% wild-type level, which is often necessary to see inhibition of DNA replication after replication protein depletion in Xenopus egg extracts.
Immunoprecipitation and Western blot
The immunoprecipitations were usually performed as follows: Cells were lysed in lysis buffer (25 mM HEPES-KOH at pH 7.6, 150 mM KAc, 5 mM MgCl2, 1 mM Na2 EGTA, 10% glycerol, 0.1% Nonidet P-40, protease inhibitor) for 20 min on ice, followed by sonication. After centrifugation, the resulting supernatants were mixed with antibody or prebleed for immunoprecipitation for 2 h, followed by incubation with protein A beads for 1 h. Beads were then washed three times with lysis buffer. Associated proteins were eluted by incubating beads with SDS loading buffer for immunoblotting. For immunoprecipitation of Mcm10 in Figure 1, native lysis and wash buffer contained 150 mM NaCl, 50 mM Tris-HCl (pH 7.4), 0.2% NP40, 2 mM EDTA, and protease inhibitor cocktail. For denaturing washes, the solution used was as above with the addition of 1% NP-40, 1% Deoxycholic acid, and 0.5% SDS. For And-1 immunoprecipitates in Figure 1B, HCT116 cells were treated with MG132 (10 µM) for 5 h, lysed in 500 µL of lysis buffer as above. After sonication and centrifugation, supernatants (
1000 µg) were mixed with 2 µL of antibody or prebleed for immunoprecipitation as above.
For results shown in Figure 6B, 293T cells overexpressing Flag-And-1 were lysed, and indicated amounts of anti-XAnd-1 antibodies were added to 500 µL lysates and mixed for 1 h at 4°C. Anti-Flag agarose was then used to immunoprecipitate Flag-And-1 and associated proteins. All immunoprecipitates were resolved by SDS-PAGE and immunoblotted for Flag-And-1 and for associated Mcm10.
For Western blots, cells were harvested by trypsinization in cold trypsin solution (2–3 min), followed by one quick wash in cold PBS solution. SDS loading buffer was then added to cell pellets to lyse cells, followed by sonication and boiling. Proteins were resolved by SDS-PAGE. To ensure that the decrease in p180 protein level after And-1 depletion was not due to post-lysis proteolysis, cells were also lysed directly into SDS-PAGE sample buffer to inactivate all cellular proteases (Supplementary Fig. S2).
Immunofluorescence
Cells grown on cover slips were extracted with CSK buffer (100 mM NaCl, 300 mM sucrose, 3mM MgCl2, 10 mM PIPES at pH 7.0) containing 0.5% Triton X-100 at room temperature before fixation in 4% paraformaldehyde in PBS for 15 min at room temperature. Cells were then blocked with 3% BSA in PBS-T (0.02% Tween-20) solution for 1 h. Primary antibodies were added at 1:500 dilution and incubated for 1 h at room temperature. After washing in 3% BSA PBS-T solution, tetramethylrhodamine isothiocyante- or fluorescein isothiocyanate-conjugated secondary antibody was then added and incubated at room temperature for 1 h. Finally, cells were washed and fixed in mounting medium with 4',6-diamidino-2-phenylindole (DAPI) (Vector Laboratories) for confocal microscopy (2-h time point) immunofluorescence microscopy (6-h time point).
Cell synchronization
Cells were treated with 2 mM thymidine for 12 h, washed, and then released into thymidine-free medium for 12 h. Aphidicolin was then added to a final concentration of 1 µg/mL, and cells were incubated for an additional 12 h. Cells were washed four times with PBS and incubated in serum-containing medium. Samples for FACS analysis, immunostaining, and lysis were collected at the times indicated in Figure 1D.
Silver staining and protein extraction
Following electrophoresis, the gel was fixed in 50% methanol, 5% acetic acid for 20 min, and then washed in 50% methanol and deionized water for 10 min each. The gel was sensitized for 5 min by incubation in 0.02% sodium thiosulfate. Following two 1-min rinses in water, the gel was immersed in 0.1% silver-nitrate solution and incubated for 30 min at 4°C. After rinsing twice with water, the staining was developed in 0.04% formalin containing 2% sodium carbonate and then rinsed in 5% acetic acid. The gel was stored in 1% acetic acid until bands were excised for mass spectroscopy.
|
Acknowledgments |
|---|
|
TopAbstractResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
|
Footnotes |
|---|
E-MAIL ad8q{at}virginia.edu; FAX (434) 924-5069.
Supplemental material is available at http://www.genesdev.org.
Article published online ahead of print. Article and publication date are online at http://www.genesdev.org/cgi/doi/10.1101/gad.1585607
|
References |
|---|
|
TopAbstractResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
Arias, E.E. and Walter, J.C. 2006. PCNA functions as a molecular platform to trigger Cdt1 destruction and prevent re-replication. Nat. Cell Biol. 8: 84–90.[CrossRef][Medline]
Bell, S.D. 2006. Molecular biology: Prime-time progress. Nature 439: 542–543.[CrossRef][Medline]
Bell, S.P. and Dutta, A. 2002. DNA replication in eukaryotic cells. Annu. Rev. Biochem. 71: 333–374.[CrossRef][Medline]
Blow, J.J. and Tanaka, T.U. 2005. The chromosome cycle: Coordinating replication and segregation. Second in the cycles review series. EMBO Rep. 6: 1028–1034.[CrossRef][Medline]
Bowman, G.D., O’Donnell, M., and Kuriyan, J. 2004. Structural analysis of a eukaryotic sliding DNA clamp–clamp loader complex. Nature 429: 724–730.[CrossRef][Medline]
Chen, J., Jackson, P.K., Kirschner, M.W., and Dutta, A. 1995. Separate domains of p21 involved in the inhibition of Cdk kinase and PCNA. Nature 374: 386–388.[CrossRef][Medline]
Dornreiter, I., Erdile, L.F., Gilbert, I.U., von Winkler, D., Kelly, T.J., and Fanning, E. 1992. Interaction of DNA polymerase -primase with cellular replication protein A and SV40 T antigen. EMBO J. 11: 769–776.[Medline]
Formosa, T. and Nittis, T. 1999. Dna2 mutants reveal interactions with DNA polymerase and Ctf4, a Pol accessory factor, and show that full Dna2 helicase activity is not essential for growth. Genetics 151: 1459–1470.
Gambus, A., Jones, R.C., Sanchez-Diaz, A., Kanemaki, M., van Deursen, F., Edmondson, R.D., and Labib, K. 2006. GINS maintains association of Cdc45 with MCM in replisome progression complexes at eukaryotic DNA replication forks. Nat. Cell Biol. 8: 358–366.[CrossRef][Medline]
Gillespie, P.J. and Hirano, T. 2004. Scc2 couples replication licensing to sister chromatid cohesion in Xenopus egg extracts. Curr. Biol. 14: 1598–1603.[CrossRef][Medline]
Hanna, J.S., Kroll, E.S., Lundblad, V., and Spencer, F.A. 2001. Saccharomyces cerevisiae CTF18 and CTF4 are required for sister chromatid cohesion. Mol. Cell. Biol. 21: 3144–3158.
Harris, S.D. and Hamer, J.E. 1995. sepB: An Aspergillus nidulans gene involved in chromosome segregation and the initiation of cytokinesis. EMBO J. 14: 5244–5257.[Medline]
Huang, S.G., Weisshart, K., Gilbert, I., and Fanning, E. 1998. Stoichiometry and mechanism of assembly of SV40 T antigen complexes with the viral origin of DNA replication and DNA polymerase -primase. Biochemistry 37: 15345–15352.[CrossRef][Medline]
Izumi, M., Yatagai, F., and Hanaoka, F. 2001. Cell cycle-dependent proteolysis and phosphorylation of human Mcm10. J. Biol. Chem. 276: 48526–48531.
Izumi, M., Yatagai, F., and Hanaoka, F. 2004. Localization of human Mcm10 is spatially and temporally regulated during the S phase. J. Biol. Chem. 279: 32569–32577.
Jeruzalmi, D., O’Donnell, M., and Kuriyan, J. 2001. Crystal structure of the processivity clamp loader () complex of E. coli DNA polymerase III. Cell 106: 429–441.[CrossRef][Medline]
Kawasaki, Y., Hiraga, S., and Sugino, A. 2000. Interactions between Mcm10p and other replication factors are required for proper initiation and elongation of chromosomal DNA replication in Saccharomyces cerevisiae. Genes Cells 5: 975–989.[Abstract]
Kim, S., Dallmann, H.G., McHenry, C.S., and Marians, K.J. 1996. couples the leading- and lagging-strand polymerases at the Escherichia coli DNA replication fork. J. Biol. Chem. 271: 21406–21412.
Kohler, A., Schmidt-Zachmann, M.S., and Franke, W.W. 1997. AND-1, a natural chimeric DNA-binding protein, combines an HMG-box with regulatory WD-repeats. J. Cell Sci. 110: 1051–1062.[Abstract]
Kong, X.P., Onrust, R., O’Donnell, M., and Kuriyan, J. 1992. Three-dimensional structure of the subunit of E. coli DNA polymerase III holoenzyme: A sliding DNA clamp. Cell 69: 425–437.[CrossRef][Medline]
Kouprina, N., Kroll, E., Bannikov, V., Bliskovsky, V., Gizatullin, R., Kirillov, A., Shestopalov, B., Zakharyev, V., Hieter, P., and Spencer, F. 1992. CTF4 (CHL15) mutants exhibit defective DNA metabolism in the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 12: 5736–5747.
Krishna, T.S., Kong, X.P., Gary, S., Burgers, P.M., and Kuriyan, J. 1994. Crystal structure of the eukaryotic DNA polymerase processivity factor PCNA. Cell 79: 1233–1243.[CrossRef][Medline]
Lee, Y.S., Kim, H.K., Chung, S., Kim, K.S., and Dutta, A. 2005. Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation. J. Biol. Chem. 280: 16635–16641.
Lei, M., Cheng, I.H., Roberts, L.A., McAlear, M.A., and Tye, B.K. 2002. Two mcm3 mutations affect different steps in the initiation of DNA replication. J. Biol. Chem. 277: 30824–30831.
Lengronne, A., McIntyre, J., Katou, Y., Kanoh, Y., Hopfner, K.P., Shirahige, K., and Uhlmann, F. 2006. Establishment of sister chromatid cohesion at the S. cerevisiae replication fork. Mol. Cell 23: 787–799.[CrossRef][Medline]
Mayer, M.L., Pot, I., Chang, M., Xu, H., Aneliunas, V., Kwok, T., Newitt, R., Aebersold, R., Boone, C., Brown, G.W., et al. 2004. Identification of protein complexes required for efficient sister chromatid cohesion. Mol. Biol. Cell 15: 1736–1745.
McHenry, C.S. 2003. Chromosomal replicases as asymmetric dimers: Studies of subunit arrangement and functional consequences. Mol. Microbiol. 49: 1157–1165.[CrossRef][Medline]
Miles, J. and Formosa, T. 1992a. Evidence that POB1, a Saccharomyces cerevisiae protein that binds to DNA polymerase , acts in DNA metabolism in vivo. Mol. Cell. Biol. 12: 5724–5735.
Miles, J. and Formosa, T. 1992b. Protein affinity chromatography with purified yeast DNA polymerase detects proteins that bind to DNA polymerase. Proc. Natl. Acad. Sci. 89: 1276–1280.
Mimura, S. and Takisawa, H. 1998. Xenopus Cdc45-dependent loading of DNA polymerase onto chromatin under the control of S-phase Cdk. EMBO J. 17: 5699–5707.[CrossRef][Medline]
Pacek, M. and Walter, J.C. 2004. A requirement for MCM7 and Cdc45 in chromosome unwinding during eukaryotic DNA replication. EMBO J. 23: 3667–3676.[CrossRef][Medline]
Pacek, M., Tutter, A.V., Kubota, Y., Takisawa, H., and Walter, J.C. 2006. Localization of MCM2-7, Cdc45, and GINS to the site of DNA unwinding during eukaryotic DNA replication. Mol. Cell 21: 581–587.[CrossRef][Medline]
Petronczki, M., Chwalla, B., Siomos, M.F., Yokobayashi, S., Helmhart, W., Deutschbauer, A.M., Davis, R.W., Watanabe, Y., and Nasmyth, K. 2004. Sister-chromatid cohesion mediated by the alternative RF-CCtf18/Dcc1/Ctf8, the helicase Chl1 and the polymerase--associated protein Ctf4 is essential for chromatid disjunction during meiosis II. J. Cell Sci. 117: 3547–3559.
Ricke, R.M. and Bielinsky, A.K. 2004. Mcm10 regulates the stability and chromatin association of DNA polymerase-. Mol. Cell 16: 173–185.[CrossRef][Medline]
Saxena, S., Yuan, P., Dhar, S.K., Senga, T., Takeda, D., Robinson, H., Kornbluth, S., Swaminathan, K., and Dutta, A. 2004. A dimerized coiled-coil domain and an adjoining part of geminin interact with two sites on Cdt1 for replication inhibition. Mol. Cell 15: 245–258.[CrossRef][Medline]
Senga, T., Sivaprasad, U., Zhu, W., Park, J.H., Arias, E.E., Walter, J.C., and Dutta, A. 2006. PCNA is a cofactor for Cdt1 degradation by CUL4/DDB1-mediated N-terminal ubiquitination. J. Biol. Chem. 281: 6246–6251.
