Genes and Development

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


GENES & DEVELOPMENT 20:486-500, 2006
©2006 by Cold Spring Harbor Laboratory Press; ISSN 0890-9369/ $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Frock, R. L.
Right arrow Articles by Kennedy, B. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Frock, R. L.
Right arrow Articles by Kennedy, B. K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

RESEARCH PAPER

Lamin A/C and emerin are critical for skeletal muscle satellite cell differentiation

Richard L. Frock1, Brian A. Kudlow2, Angela M. Evans1, Samantha A. Jameson1, Stephen D. Hauschka1,3,4 and Brian K. Kennedy1,3,5

1 Department of Biochemistry, 2 Molecular and Cellular Biology Program, University of Washington, Seattle, Washington 98195, USA


    Abstract
 Top
 Abstract
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Mutations within LMNA, encoding A-type nuclear lamins, are associated with multiple tissue-specific diseases, including Emery-Dreifuss (EDMD2/3) and Limb-Girdle muscular dystrophy (LGMD1B). X-linked EDMD results from mutations in emerin, a lamin A-associated protein. The mechanisms through which these mutations cause muscular dystrophy are not understood. Here we show that most, but not all, cultured muscle cells from lamin A/C knockout mice exhibit impaired differentiation kinetics and reduced differentiation potential. Similarly, normal muscle cells that have been RNA interference (RNAi) down-regulated for either A-type lamins or emerin have impaired differentiation potentials. Replicative myoblasts lacking A-type lamins or emerin also have decreased levels of proteins important for muscle differentiation including pRB, MyoD, desmin, and M-cadherin; up-regulated Myf5; but no changes in Pax3, Pax7, MEF2C, MEF2D, c-met, and beta-catenin. To determine whether impaired myogenesis is linked to reduced MyoD or desmin levels, these proteins were individually expressed in Lmna–/– myoblasts that were then induced to undergo myogenesis. Expression of either MyoD or, more surprisingly, desmin in Lmna–/– myoblasts resulted in increased differentiation potential. These studies indicate roles for A-type lamins and emerin in myogenic differentiation and also suggest that these effects are at least in part due to decreased endogenous levels of other critical myoblast proteins. The delayed differentiation kinetics and decreased differentiation potential of lamin A/C-deficient and emerin-deficient myoblasts may in part underlie the dystrophic phenotypes observed in patients with EDMD.

[Keywords: MyoD; desmin; pRB; myoblast; myogenesis; Emery-Dreifuss muscular dystrophy]

Received August 15, 2005; revised version accepted December 27, 2005.


Nuclear lamins are the major constituents of the nuclear lamina, a proteinaceous network underlying the inner nuclear membrane (Hutchison and Worman 2004Go; Mounkes and Stewart 2004Go; Zastrow et al. 2004Go; Smith et al. 2005Go). Expression of A-type lamins, in contrast to the homologous B-type lamins, is largely restricted to differentiated tissues with high expression in skeletal muscle (Rober et al. 1989Go). Lamins A and C (henceforth referred to as lamin A/C) are the major products of the LMNA gene.

Greater than 100 mutations in LMNA have been linked to 10 human genetic disorders, broadly termed laminopathies (for review, see Mounkes et al. 2003Go). The majority of LMNA mutations identified thus far are linked to Emery-Dreifuss muscular dystrophy (EDMD2/3) (Bonne et al. 1999Go). Mice lacking lamin A/C develop a form of muscular dystrophy closely resembling EDMD and die by 8 wk from cardiac and skeletal myopathies (Sullivan et al. 1999Go). Mutations within the gene encoding the lamin A/C-binding protein, emerin (EMD), cause an X-linked form of Emery-Dreifuss muscular dystrophy (EDMD1) (Bione et al. 1994Go; Gruenbaum et al. 2005Go). It is not known what role A-type lamins play in skeletal muscle development, let alone how mutations within LMNA cause EDMD. One possibility is that mutations that alter lamin A/C's nuclear integrity or impair its function(s) would then result in degeneration of cells under high mechanical stress, such as skeletal muscle (Broers et al. 2004Go; Lammerding et al. 2004Go). A second, nonexclusive possibility is that lamin A/C plays a role in muscle differentiation, and alterations in its activity result in delayed or decreased expression of genes important for differentiation and/or the stable maintenance of the differentiated state. Inefficient muscle differentiation may ultimately result in a dystrophic syndrome, when the balance between muscle degeneration and renewal becomes skewed.

In adults, the vast majority of new skeletal muscle comes from myogenic precursor cells called satellite cells that require Pax3/Pax7 for their specification and self-renewal (Oustanina et al. 2004Go; Relaix et al. 2005Go). These adult stem cells are able to proliferate and produce myoblasts, which in turn are capable of withdrawing from the cell cycle and terminally differentiating into skeletal muscle (for review, see Charge and Rudnicki 2004Go). A number of transcription factors and structural proteins have been implicated in this transition (Parker et al. 2003Go; Paulin and Li 2004Go); for example, the myogenic regulatory factor MyoD is expressed prior to myocyte differentiation (Buskin and Hauschka 1989Go; Lassar et al. 1989Go) and, together with MEF2 transcription factors, is crucial for satellite cell terminal differentiation (Sabourin et al. 1999Go; Yablonka-Reuveni et al. 1999Go; McKinsey et al. 2002Go). The retinoblastoma protein (pRB), is likewise important for the proliferation to differentiation transition during myogenesis (Maione et al. 1994Go; Zacksenhaus et al. 1996Go; Huh et al. 2004Go). Although the mechanism is not fully understood, pRB is thought to potentiate MyoD activity during muscle differentiation (Novitch et al. 1996Go, 1999Go; Puri et al. 2001Go; Guo et al. 2003Go).

Several structural and cell surface proteins also play important roles in terminal differentiation. Desmin, a muscle-specific intermediate filament protein, is one of the first proteins expressed upon satellite cell activation (Lazarides and Hubbard 1976Go; Kaufman et al. 1991Go). Its exact role in myogenesis remains unclear; but differentiation is slightly delayed during regeneration in desmin knockout mice (Li et al. 1994Go; Weitzer et al. 1995Go; Smythe et al. 2001Go). M-cadherin, a cell surface adhesion protein, is a marker for satellite cells in vivo, and its experimental perturbation also delays the onset of differentiation (Zeschnigk et al. 1995Go; Kaufmann et al. 1999Go).

Do A-type lamins play roles in muscle differentiation? A recent study reported that overexpression of a lamin A EDMD mutation, R453W, inhibits the in vitro differentiation of C2C12 myoblasts (Favreau et al. 2004Go). Subsequent studies showed that overexpression of a different EDMD mutation, W520S, also inhibited C2C12 myoblast differentiation, and provided evidence that nucleoskeleton remodeling is necessary for skeletal muscle differentiation (Markiewicz et al. 2005Go). Finally, Arimura et al. (2005Go) constructed an EDMD mouse carrying H222P mutations in both lamin A alleles and found that adult mice developed muscular dystrophy and exhibited elevated levels of Smads 2 and 4 in cardiac and skeletal muscle nuclei. Here, we focus on an EDMD mouse model in which the lamin A gene has been knocked out (Sullivan et al. 1999Go), and report that Lmna–/– and even Lmna+/– myoblasts display a dramatically compromised differentiation potential. Lmna+/+ cells stably expressing a small interfering RNA (siRNA) targeted to Lmna are similarly compromised. Interestingly, myoblasts with siRNA-reduced emerin display a similar differentiation phenotype. Furthermore, myoblasts with reduced lamin A/C or emerin also contain reduced levels of at least four proteins important for differentiation and/or the maintenance of the differentiated state: MyoD, desmin, pRB, and M-cadherin. Exogenous expression of MyoD in Lmna–/– myoblasts restores their differentiation kinetics, but more surprisingly, forced expression of desmin is sufficient to restore much of their differentiation potential, suggesting that reduced MyoD and desmin transcription may be primary factors underlying the poor differentiation capacity of cells deficient in A-type lamin function.


    Results
 Top
 Abstract
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 

Generation of Lmna–/– myoblasts

To determine the myogenic potential of cells with reduced lamin A/C function, we generated permanent myoblast cell lines from Lmna+/+, Lmna+/–, and Lmna–/– mouse hind leg muscles (see Materials and Methods). To avoid accidental selection of cells with unique attributes during the generation of permanent myoblast lines, primary cultures were grown at densities that permitted thousands of individual muscle colony-forming cells to proliferate into colonies, while most fibroblasts grew poorly. Previous studies indicate that when most mouse primary satellite-cell-derived muscle colonies are subcloned and individually expanded, their descendents undergo proliferative senescence after 20–40 cell cycles and small numbers of spontaneously transformed myoblasts emerge (Hauschka et al. 1979Go; Neville et al. 1997Go). Even after decades of expansion, the descendents exhibit biochemical characteristics that are very close to those of primary satellite cells (Cornelison 1998Go). Importantly, the cells in each of the permanent cell lines generated are Pax3- and Pax7-positive (see below); thus potentially immortalized fibroblasts did not contribute to the myogenic Lmna+/+, Lmna+/–, and Lmna–/– cell lines. Western analysis confirmed that lamin A and C bands were absent in Lmna–/– muscle cells and were reduced ~50% in Lmna+/– cells (Fig. 1A).


Lmna–/– and Lmna+/– muscle cells have delayed differentiation kinetics

The onset of terminal differentiation in satellite cell-derived skeletal muscle cultures is regulated by growth factors. In the presence of bFGF and horse serum, mouse myoblasts grow exponentially. Upon bFGF removal, myoblasts continue cycling for ~6 h as residual mitogenic signals attenuate; cells then stop entering S phase and undergo an irreversible commitment to terminal differentiation. Typically, >90% of the population commits to terminal differentiation as mitogen-deprived cells complete mitosis and enter the G1/G0 cell cycle compartment. Committed cells activate expression of muscle-specific genes such as myosin heavy chain (MyHC), repress growth factor receptor expression, and are refractory to subsequent mitogenic stimulation (Clegg et al. 1987Go; Olwin and Hauschka 1988Go; Templeton and Hauschka 1992Go; Angello and Hauschka 1996Go). The kinetics of skeletal muscle differentiation after bFGF removal can thus be approximated by determining the percentage of cells in S phase by BrdU incorporation and the percentage of cells that exhibit immuno-positive staining for MyHC.


Figure 1
View larger version (63K):
[in this window]
[in a new window]
 
Figure 1. Lmna–/– muscle cells have delayed differentiation kinetics. (A) Western analysis indicating the lamin A/C proteins present in the permanent Lmna+/+, Lmna+/–, and Lmna–/– myoblast cell lines. (B) Fraction of S-phase cells following bFGF removal as measured by cells staining positively for BrdU incorporation in Lmna+/+, Lmna+/–, and Lmna–/– cultures. After 12 h of bFGF deprivation, 40% of Lmna–/– muscle cells remain in S phase compared with ~20% of Lmna+/+ cells. (C) The appearance of terminally differentiated muscle protein as measured by cells staining positively for MyHC in identical bFGF-deprived cultures. By 48 h, only ~30% of Lmna–/– cells were MyHC-positive compared with ~90% in Lmna+/+ cells. Lmna+/– muscle cells display an intermediate differentiation phenotype relative to Lmna+/+ and Lmna–/– muscle cells. Cell counts are based on three experiments with ~350 cells counted per time point. (DI) Immunostained Lmna+/+ and Lmna–/– muscle cells at 12 h (D,E), 24 h (F,G), and 48 h (H,I) after mitogen withdrawal. BrdU is in green with arrowheads indicating BrdU-positive cells, MyHC is in red, and Dapi is in blue.

 
The timing of myogenic terminal differentiation was compared among Lmna+/+, Lmna+/–, and Lmna–/– muscle cells. Initially, 40%–50% of the myoblasts of each genotype are in S phase; this is consistent with the predicted 42% S-phase cells in cultures with a 19-h cell cycle and a typical 8-h S phase (Clegg et al. 1987Go). After 12 h >40% of Lmna–/– myoblasts remain in S phase compared with ~25% of Lmna+/+ cells (Fig. 1B,D,E); and differences in proliferation still remain after 24 h. These findings indicate that myoblasts with reduced lamin A/C are delayed in their ability to exit the cell cycle in response to mitogen deprivation.

Consistent with the delay in cell cycle withdrawal, the appearance of MyHC-positive cells is delayed ~24 h in Lmna–/– compared with Lmna+/+ cells (Fig. 1C,F,G). Forty-eight hours after bFGF removal, only ~30% of Lmna–/– cells were MyHC-positive compared with ~85% of Lmna+/+ cells (Fig. 1C,H,I). These data indicate that upon growth factor withdrawal, Lmna–/– muscle cells are also slower to exhibit the gene expression properties of differentiated muscle. Lmna+/– muscle cells are likewise compromised, exhibiting an intermediate differentiation phenotype between that of Lmna+/+ and Lmna–/– cells.

The slower differentiation kinetics of Lmna–/– muscle cells could be explained by a lag in responsiveness to FGF removal after which, given sufficient time, a majority of cells become myocytes; alternatively, the Lmna–/– population may contain some cells capable of normal differentiation and other cells that are unable to terminally differentiate. These possibilities were analyzed by clonal assays in which colonies were grown in bFGF-containing media for 5 d then switched to bFGF-free media and the relative differentiation capacity of individual clones from each cell line was assessed after increasing periods of mitogen deprivation. The extent of differentiation was assessed by determining the percentage of nuclei in MyHC-positive cells. Individual colonies were then subdivided into four arbitrary categories: 0% MyHC+, <30% MyHC+, 30%–60% MyHC+, and 60%–95% MyHC+, and the data were plotted for clones fixed 4–10 d following mitogen removal (Fig. 2A). In Lmna+/+ cultures, >95% of the total colonies contained MyHC+ cells by day 4, while Lmna–/– and Lmna+/– cultures contained 10%–20% fewer MyHC+ colonies (Fig. 2B); and whereas ~80% of the Lmna+/+ colonies were highly differentiated after 4 d, no Lmna–/– clones and only ~25% of the Lmna+/– clones were highly differentiated. Significantly, as the post-mitogen withdrawal period increased, <3% of the total Lmna–/– colonies ever became highly differentiated, only ~20% ever acquired an intermediate (30%–60% MyHC+) level of differentiation, and the fraction of colonies exhibiting low differentiation levels (<30% MyHC+ cells) increased only slightly. Lmna+/– clones, while more differentiated than Lmna–/– clones, also exhibited only marginal increases in differentiation at longer periods of mitogen withdrawal. These results are consistent with the hypothesis that most Lmna–/– myoblasts are compromised with respect to their differentiation potential. (Evidence that the impaired differentiation phenotype of most Lmna–/– and some Lmna+/– clones is not due to the common "differentiation-defective" phenotype observed in many permanent mouse and rat myogenic cell lines [Lim and Hauschka 1984Go] is provided below.)


Figure 2
View larger version (64K):
[in this window]
[in a new window]
 
Figure 2. Lmna–/– muscle cells have reduced differentiation potential. (A) Method for the clonal analysis of differentiation: Cells are plated at low cell densities and given 5 d to form colonies, then switched to FGF-free, low-serum media to induce differentiation. The relative differentiation capacity of individual clones from each cell line was measured at successive days of mitogen deprivation. Fixed cultures were immunostained for MyHC (brown) and counterstained for total cells with 1% methylene blue (light blue). Clones were then subdivided into four arbitrary categories based on percentage of nuclei in MyHC+ cells: 0%, <30%, 30%–60%, and 60%–95%. (B) Clonal analysis of differentiation for Lmna+/+, Lmna+/–, and Lmna–/– muscle cells from 4 to 10 d of differentiation. Approximately 80% of clones in Lmna+/+ cultures were highly differentiated at day 4, whereas none of the Lmna–/– colonies were similarly differentiated. As the post-mitogen withdrawal period increased, <3% of the Lmna–/– colonies ever became highly differentiated. Consistent with mass culture differentiation (see Fig. 1C), Lmna+/– muscle cells display an intermediate differentiation phenotype relative to Lmna+/+ and Lmna–/– muscle cells. Approximately 100 clones were scored per time point.

 

Lmna–/– myoblasts exhibit both altered and normal levels of transcription factors and other key myogenic components

Since differences between Lmna+/+ and Lmna–/– muscle cell differentiation are apparent as early as 12 h after bFGF removal, the compromised Lmna–/– differentiation phenotype could be due to altered levels or activity of critical regulatory factors in myoblasts prior to the initiation of terminal differentiation. For example, myoblasts from MyoD–/– mice also exhibit delayed cell cycle withdrawal kinetics when deprived of growth factors (Sabourin et al. 1999Go). This hypothesis was examined via Western blot analysis of proliferating Lmna–/– and Lmna+/+ myoblasts (Fig. 3A). This disclosed that in Lmna–/– myoblasts MyoD protein levels were reduced by >60% while the levels of Myf-5, a related basic helix–loop–helix (bHLH) transcription factor whose expression is often up-regulated in response to decreased MyoD levels (Rudnicki et al. 1992Go), were highly increased. Several studies have demonstrated that pRB acts synergistically with MyoD to activate transcription of muscle specific factors (Puri et al. 2001Go; Guo et al. 2003Go), and that pRB is also required for cell cycle exit accompanying muscle differentiation (Novitch et al. 1996Go, 1999Go; Huh et al. 2004Go). pRB Western blot analysis indicated that steady-state levels of both hyper- and hypo-phosphorylated pRB were dramatically reduced in Lmna–/– myoblasts compared with Lmna+/+ controls (Fig. 3A). In contrast to the MyoD, Myf-5, and pRB changes, the protein levels of several other key myogenic transcription factors: MEF2C, MEF2D, Pax3, and Pax7 were unperturbed in proliferating Lmna–/– myoblasts.


Figure 3
View larger version (54K):
[in this window]
[in a new window]
 
Figure 3. MyoD, pRB, desmin, and M-cadherin proteins are reduced in proliferating Lmna–/– myoblasts. (A) Western analysis comparing relative protein levels of myogenic factors in Lmna+/+ and Lmna–/– myoblasts. MyoD, pRB, desmin, and M-cadherin proteins are reduced, whereas Myf-5 protein levels are increased in Lmna–/– myoblasts. In addition, Pax7, Pax3, MEF2C, MEF2D, c-met, and beta-catenin proteins are unaffected in Lmna–/– myoblasts. (B) QPCR analysis comparing the relative mRNA's of desmin, MyoD, and pRB in Lmna+/+ and Lmna–/– myoblasts. Desmin and MyoD mRNA's are 4.5-fold and threefold reduced in Lmna–/– myoblasts, whereas Rb mRNA is not affected. Data represent averages of triplicate experiments performed at three different dilutions of cDNA. Fold changes were measured by comparing Ct values from Lmna+/+ and Lmna–/– myoblast mRNAs that were normalized against Hprt.

 
It also seemed informative to determine whether Lmna–/– myoblasts exhibited altered levels of important myogenic structural and signaling proteins. The muscle-specific cytoplasmic intermediate filament protein desmin was analyzed in Lmna–/– myoblasts for several reasons. First, desmin is required for normal differentiation in vitro (Li et al. 1994Go; Weitzer et al. 1995Go), and desmin knockout myoblasts also have prolonged cell cycle withdrawal kinetics and delayed fusion in vivo (Smythe et al. 2001Go). Second, MyoD–/– primary mouse myoblasts do not express desmin (Sabourin et al. 1999Go). Third, EM studies have found abnormal desmin localization in Lmna–/– cardiomyocytes (Nikolova et al. 2004Go). Interestingly, desmin protein levels were significantly reduced in proliferating Lmna–/– myoblasts (Fig. 3A). Because reduced desmin levels might have resulted in compensation by other cytoplasmic intermediate filament proteins such as vimentin and nestin, the levels of these proteins were also examined in Lmna–/– myoblasts. However, vimentin and nestin occur at normal levels in myoblasts lacking lamin A/C (data not shown).

The Ca+-dependent cell adhesion protein M-cadherin was analyzed because its gene is activated by MyoD (Sabourin et al. 1999Go; Cornelison et al. 2000Go) and because M-cadherin plays roles in cell fusion and other aspects of myogenesis (Zeschnigk et al. 1995Go; Kang et al. 2003Go). M-cadherin protein levels were also significantly reduced in Lmna–/– myoblasts relative to Lmna+/+ myoblasts (Fig. 3A). The tyrosine kinase receptor c-met was analyzed because its overexpression is known to inhibit myogenic differentiation (Anastasi et al. 1997Go), and beta-catenin was analyzed because it is known to play multiple roles during myogenesis (Petropoulos and Skerjanc 2002Go), but neither protein exhibited altered levels in Lmna–/– myoblasts (Fig. 3A). Taken together, these results indicate that myoblasts lacking lamin A/C exhibit several major differences in regulatory, structural, and signaling components, one or more of which could potentially account for the compromised differentiation of Lmna–/– myoblasts in response to growth factor deprivation.


MyoD and desmin, but not Rb, transcripts, are reduced in Lmna–/– myoblasts

Why are the levels of MyoD, desmin, and pRB proteins reduced in proliferating Lmna–/– myoblasts? Quantitative PCR (QPCR) was used to determine whether reduced levels of the three proteins correlated with changes in transcript levels. MyoD and Des transcript levels were reduced by more than threefold and 4.5-fold, respectively, in the Lmna–/– myoblasts (Fig. 3B). In contrast, Rb transcript levels were unaffected in Lmna–/– myoblasts relative to Lmna+/+ myoblasts (Fig. 3B). We posit that pRB protein stability is reduced in these cells, perhaps through enhanced proteasome-dependent degradation, as has been observed in Lmna–/– fibroblasts (Johnson et al. 2004Go).


Individual Lmna–/– myoblasts express variable levels of MyoD and desmin, but normal levels of Pax7

Clonal analysis of Lmna–/– myoblasts indicates that fewer cells in most colonies retain the capacity to differentiate rapidly upon bFGF removal, and most cells fail to differentiate even after long time periods. We considered several explanations for these differences with respect to MyoD, desmin, and Pax7 levels. First, there may be several subpopulations of Lmna–/– cells: one with near-normal levels of proteins required for the myogenic program, which retain a full differentiation potential, and others with variably decreased expression of MyoD and/or desmin that have lower probabilities of differentiation. Alternatively, one or more of these proteins may be reduced in all cells, again leading to lower probabilities of differentiation. To distinguish between these possibilities, single Lmna–/– myoblasts were immunostained using antibodies to either desmin or MyoD (Fig. 4A). About 70% of Lmna–/– myoblasts exhibit low or undetectable desmin immunofluorescence, whereas 30% exhibit relatively normal staining (Fig. 4B). In Lmna+/+ control myoblasts, only a small percentage (~4%) exhibited low or undetectable desmin staining. MyoD staining was also reduced in Lmna–/– cells and again was nonuniformly distributed in individual cells (Fig. 4A). In this case, however, a higher percentage of Lmna–/– myoblasts (~57%) retained a detectable signal (Fig. 4B). To address the myogenic status of the MyoD-negative Lmna–/– myoblasts, cells were immunostained for Pax7 protein. Consistent with Western analysis (Fig. 3A), both Lmna+/+ and Lmna–/– myoblasts are highly Pax7-positive. Furthermore, 96% (144/150 cells) of the MyoD-negative Lmna–/– myoblasts are also Pax7-positive (Fig. 4C), thus suggesting most MyoD-negative-Lmna–/– myoblasts retain some myogenic identity (Relaix et al. 2005Go).


Figure 4
View larger version (68K):
[in this window]
[in a new window]
 
Figure 4. Lmna–/– myoblasts exhibit mixed heterogeneity with respect to MyoD and desmin expression. (A) Immunostaining of Lmna+/+ and Lmna–/– myoblasts using antibodies to MyoD (red) and desmin (green). Images are a two-dimensional representation of serial images taken throughout the cells (volume view). When present, MyoD and Pax7 occupy the entire nucleus, whereas desmin is localized to a portion of the cytoplasm. (B) Graph summarizing cell counts of MyoD and desmin immunopositive cells in Lmna+/+ and Lmna–/– myoblasts. Only ~30% of Lmna–/– myoblasts are desmin-positive and ~57% of Lmna–/– myoblasts are MyoD-positive. Data represent average from three different experiments, ~400 cells/experiment. (C) Indirect immunofluorescence of Lmna+/+ and Lmna–/– myoblasts using antibodies to MyoD (red) and Pax7 (green) with Dapi (blue) for total cells. Arrows indicate MyoD-negative cells that are Pax7-positive. As in A, images are presented as a volume view.

 

RNA interference (RNAi)-mediated silencing of Lmna impairs differentiation and leads to reduced MyoD and desmin protein levels

To eliminate the possibility that the phenotypes of Lmna–/– myoblasts were due to inadvertent cell culture selection for differentiation-defective muscle cells, we tested whether the reduced differentiation potential of Lmna–/– myoblasts could be phenocopied by reducing lamin A/C levels via siRNA targeting of the Lmna mRNAs (Brummelkamp et al. 2002Go). Lmna+/+ myoblasts were stably transduced with retroviruses expressing short hairpin RNAs targeted to the Lmna transcript, and control Lmna+/+ myoblasts were transduced with RNAi targeted to EGFP (see Materials and Methods). Lamin A/C protein levels were reduced ~10-fold under these conditions (Fig. 5A). It should be noted that these cells express almost no detectable lamin C since the RNAi targets endogenous mRNAs encoding both lamin A and lamin C. To test their ability to differentiate, both the EGFP-RNAi Lmna+/+ and Lmna-RNAi Lmna+/+ muscle cells were subjected to myogenic clonal analysis. Importantly, the clonal assays were initiated within 4 d of the siRNA transduction, thereby eliminating the possibility of gradual in vitro selection for differentiation-defective myoblasts. The expression of the EGFP-RNAi in Lmna+/+ myoblasts had no effect on cell differentiation. In contrast, as with Lmna–/– myoblasts, Lmna-RNAi Lmna+/+ muscle cells produced fewer well-differentiated clones than the control EGFP-RNAi Lmna+/+ muscle cells (Fig. 5C). Also consistent with the phenotype of Lmna–/– myoblasts, protein levels of both MyoD and desmin are reduced in Lmna+/+ myoblasts expressing the Lmna-RNAi (Fig. 5B). However, the protein levels of pRB are only slightly decreased in Lmna-RNAi Lmna+/+ myoblasts (Fig. 5B). Therefore, the phenotypes of Lmna–/– muscle cells are generally, but not completely, recapitulated by reducing lamin A/C expression in Lmna+/+ cells.


Expression of lamin A rescues muscle differentiation in Lmna-silenced Lmna+/+ myoblasts but not in Lmna–/– myoblasts

To confirm that defects in myogenic differentiation observed in myoblasts with reduced lamin A/C levels are indeed specific to the loss of lamin, we attempted to rescue the differentiation defects by stable reintroduction of lamin A. So that the attempted phenotypic rescue of Lmna–/– myoblasts could be compared with rescue of Lmna-silenced Lmna+/+ myoblasts, the lamin A "rescue cDNA" was designed to contain several silent codon changes at the target site of the siRNA, thereby rendering it resistant to the siRNA (lamin A-SiR; see Materials and Methods). Lmna+/+ myoblasts that had been stably transduced with either EGFP-RNAi or Lmna-RNAi were subjected to a second round of retroviral transduction and selection for stably transduced myoblasts that express lamin A-SiR (Fig. 5B). Analysis of the Lmna-RNAi-transduced myoblasts indicates that the protein levels of MyoD and desmin are restored to wild-type levels (Fig. 5B) and that they differentiate normally (Fig. 5C), consistent with the hypothesis that the defective differentiation of Lmna-silenced Lmna+/+ myoblasts is indeed a direct result of reduced lamin A/C expression. However, attempts to obtain the same phenotypic rescue by expressing lamin A in Lmna–/– myoblasts have been unsuccessful. Such cells do not exhibit increased differentiation potential relative to control Lmna–/– cells transduced with either lamin A, lamin C, or both (Fig. 5E), nor are the protein levels of MyoD and desmin restored to wild-type levels (Fig. 5D). Possible reasons for this are addressed in the Discussion.


Figure 5
View larger version (81K):
[in this window]
[in a new window]
 
Figure 5. Analysis of Lmna–/– and Lmna-RNAi-treated Lmna+/+ muscle cultures with and without the addition of lamin A. (A) Western analysis of Lmna+/+ myoblasts indicating ~10-fold reduction in lamin A/C protein levels in the presence of retrovirally transduced Lmna-RNAi. (B) Lmna+/+ myoblasts retrovirally transduced with EGFP-RNAi alone, Lmna-RNAi alone, Lmna-RNAi + lamin A-SiR, or EGFP-RNAi + lamin A-SiR were probed for relative amounts of MyoD, pRB, and desmin proteins. Protein levels of MyoD and desmin are reduced in Lmna+/+ myoblasts expressing the Lmna-RNAi, but can be recovered when lamin A-SiR is subsequently expressed in the same cells. Protein levels of pRB are slightly reduced when Lmna-RNAi is expressed. (C) Myogenic clonal analysis of Lmna+/+ muscle cells retrovirally transduced with EGFP-RNAi alone, Lmna-RNAi alone, EGFP-RNAi + lamin A-SiR, or Lmna-RNA + lamin A-SiR. Reducing lamin A/C protein levels results in fewer clones that are highly differentiated compared with the EGFP-RNAi control; increasing lamin A protein levels in Lmna-RNAi Lmna+/+ muscle cells restores differentiation potential. Approximately 150 clones were scored per time point. (D) Retroviral transduction of lamin A, lamin C, or lamin A/C in Lmna–/– myoblasts does not restore MyoD or desmin proteins to wild-type levels. (E) Differentiation potential of Lmna–/– muscle cells is not significantly increased when lamin A, lamin C, or both are expressed. Approximately 150 clones were scored per time point.

 

Exogenous expression of desmin or MyoD in Lmna–/– myoblasts increases differentiation potential

Previous studies have demonstrated that a loss or reduction of desmin results in impaired muscle differentiation (Li et al. 1994Go; Weitzer et al. 1995Go; Smythe et al. 2001Go). Since desmin levels are reduced in myoblasts lacking lamin A/C, we hypothesized that their differentiation potential might be restored by exogenous expression of desmin. Thus, stably transduced Lmna–/– myoblast lines were created that express desmin by using a retroviral approach similar to that described for lamin A (Fig. 6A). These Lmna–/– myoblasts exhibited near normal desmin protein levels, but their MyoD levels remained low (Fig. 6A); yet despite their reduced MyoD, the percentage of well differentiated muscle colonies was two to three times greater than that of Lmna–/– myoblasts transduced with a control expression vector (Fig. 6B).

The reduction of both MyoD and desmin mRNAs in Lmna–/– muscle cells suggests that lamin A/C function might be important for efficient transcription of either or both these genes. MyoD has been shown to enhance desmin expression in vitro (Li and Capetanaki 1993Go), but this activity is reported to be specific for differentiating muscle cells, not proliferating myoblasts (Gao et al. 1998Go). To determine whether elevated MyoD expression in Lmna–/– myoblasts would rescue their compromised differentiation, cells were transduced with MyoD or control retroviral vectors. Since exogenous expression of MyoD activates the muscle differentiation program in a variety of cells (Tapscott et al. 1988Go), we used a conditional MyoD-estrogen receptor (ER) system in which MyoD-ER accumulates in the cytoplasm until the cells are exposed to beta-estradiol, which upon binding the ER moiety, targets MyoD-ER to the nucleus (Hollenberg et al. 1993Go). Stably transduced control and MyoD-ER-Lmna–/– myoblasts (Fig. 6C) were plated at clonal densities, grown for 5 d, switched to FGF-free medium in the presence or either beta-estradiol or vehicle control (+EtOH), and then periodically fixed and immunostained for MyHC (Fig. 6D). MyoD-ER-Lmna–/– colonies exposed to beta-estradiol exhibited high levels of differentiation within 2 d, whereas three different sets of control colonies exhibited delayed and less extensive differentiation. Importantly, the differentiation of beta-estradiol-treated MyoD-ER-Lmna–/– colonies was greater than that of desmin-Lmna–/– myoblasts (Fig. 6B) and equivalent to that of Lmna+/+ muscle cells (Fig. 2B).


Figure 6
View larger version (55K):
[in this window]
[in a new window]
 
Figure 6. Forced expression of desmin or MyoD in Lmna–/– myoblasts increases their differentiation potential. (A) Western blot showing that forced expression of retrovirally transduced desmin to near wild-type protein levels in Lmna–/– myoblasts does not increase MyoD protein levels. (B) Myogenic clonal analysis comparing Lmna–/– muscle cells expressing either vector control (pMSCVP) or desmin. Forced expression of desmin enhances the differentiation potential of Lmna–/– muscle cells to near wild-type levels. Approximately 250 clones were scored per time point. (C) Western analysis comparing forced expression of retrovirally transduced MyoD-ER fusion protein in Lmna–/– myoblasts to MyoD in Lmna+/+ myoblasts. (D) Clonal analysis indicates that estradiol treatment of MyoD-ER-expressing Lmna–/– muscle cells causes ~80 percent of clones to become highly differentiated, whereas control cultures (pBABE ± beta-estradiol and MyoD-ER + vehicle) exhibit few if any highly differentiated muscle clones. Approximately 150 clones were scored per time point.

 
To further investigate differences between the differentiation kinetics of MyoD-ER-Lmna–/– myoblasts and desmin-Lmna–/– myoblasts, both cell types were assayed in mass cultures during the first 48 h after FGF removal. MyoD-ER-Lmna–/– cells exhibited rapid cell cycle withdrawal and >95% of the cells were MyHC-positive within 48 h, while desmin-Lmna–/– myoblasts exhibited virtually no cell cycle withdrawal during the first 12 h and significantly lower levels of differentiation by 48 h (Table 1, red numerals; also cf. Fig. 1B,C). These findings suggest that unlike readdition of MyoD-ER, which enhances both the timing of cell cycle exit and the differentiation potential of Lmna–/– cells to wild-type levels, readdition of desmin is not sufficient to restore the normal kinetics of cell cycle exit after FGF-withdrawal of Lmna–/– cells, but constitutively expressed desmin improves myogenesis after these cells eventually withdraw from the cell cycle. Collectively, these findings indicate that the compromised differentiation potential of myoblasts lacking lamin A/C may derive from reduced levels of desmin and MyoD, and the restoration of each protein can at least partially correct the compromised levels of myogenic differentiation.


View this table:
[in this window]
[in a new window]
 
Table 1. Forced expression of MyoD, but not desmin, rescues cell cycle withdrawal and early differentiation kinetics in Lmna–/– cellsa

 

Reduced expression of Emd leads to defects in muscle differentiation

Mutations in a second gene, EMD, encoding the lamin-associated protein emerin have been identified in EDMD1. Since emerin and lamin A/C are known to interact within the nuclear envelope (Gruenbaum et al. 2005Go), we tested whether forced reduction in emerin expression would lead to defects in muscle differentiation similar to those exhibited by lamin A/C silenced cells. An RNAi specific to emerin was created and introduced in Lmna+/+ myoblasts using the same retroviral approach described previously for Lmna-RNAi. Expression of Emd-RNAi led to near total elimination of emerin protein (Fig. 7A). When these muscle cells were subjected to myogenic clonal analysis, <50% of the clones scored as highly differentiated (Fig. 7B). In addition, the protein levels of MyoD and desmin, but not pRB, are reduced to levels similar to Lmna-RNAi-treated cells (Fig. 5B). Since the levels of MyoD were reduced in Emd-RNAi Lmna+/+ myoblasts, we hypothesized that forced expression of MyoD using the MyoD-ER system described above would restore their differentiation potential. Stably transduced control and MyoD-ER-Emd-RNAi Lmna+/+ myoblasts (Fig. 7C) were plated at clonal densities, grown for 5 d, switched to FGF-free medium in the presence of either beta-estradiol or vehicle control (+EtOH), and then periodically fixed and immunostained for MyHC (Fig. 7D). Similarly to MyoD-ER-Lmna–/– myoblasts, the differentiation of beta-estradiol-treated MyoD-ER-Emd-RNAi Lmna+/+ colonies was greater than that of three different sets of control colonies (Fig. 7D) and similar to that of Lmna+/+ muscle cells (see Fig. 2B). These data suggest that readdition of MyoD in Emd-RNAi Lmna+/+ myoblasts can restore differentiation potential similar to that of Lmna+/+ myoblasts. Therefore, myoblasts with either reduced lamin A/C levels or reduced emerin levels display delayed differentiation kinetics and have reduced levels of a subset of proteins important for myogenic differentiation.


    Discussion
 Top
 Abstract
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Mutations in the genes encoding the nuclear proteins emerin and lamin A/C are associated with EDMD. Although their roles in skeletal muscle development are unknown, we demonstrate that reducing lamin A/C or emerin via Lmna knockout, Lmna-RNAi, and Emd-RNAi results in reduced levels of desmin and MyoD in myoblasts, and that each of the independent perturbations causes a similar set of compromised differentiation phenotypes. Restoration of MyoD, and more surprisingly desmin, significantly increases the differentiation potential of lamin A/C-deficient myoblasts, suggesting that reduced levels of these proteins may underlie the differentiation impairment of Lmna–/– muscle cells.


Differentiation defects in myoblasts lacking A-type lamins or emerin

The reduction in desmin and MyoD transcripts in Lmna–/– myoblasts suggests that A-type lamins are directly or indirectly affecting the transcription of both genes. Previous studies indicated that desmin is a target gene for MyoD, although MyoD dependence was reported to be important for proper levels of desmin transcription only after induction of terminal differentiation (Gao et al. 1998Go). However, our studies indicate a 4.5-fold reduction of desmin mRNA in Lmna–/– myoblasts. Does the reduction or absence of A-type lamins have nonspecific global effects on the transcription of many genes, some of which happen to play important roles in muscle differentiation, or does lamin A/C affect specific gene targets important for maintaining the myogenic determination of skeletal muscle cells? A-type lamins interact with and organize chromatin (Glass et al. 1993Go) in a manner possibly mediated through lamin–histone interactions (Taniura et al. 1995Go). Therefore, loss or reduction of lamin A/C could affect the expression of numerous genes. In addition, A-type lamins have been shown to directly interact with transcription factors such as pRB (Ozaki et al. 1994Go; Markiewicz et al. 2002Go), SREBP-1 (Lloyd et al. 2002Go), and MOK2 (Dreuillet et al. 2002Go), implying that they could also act as accessory proteins for a subset of tissue-defining factors. Our data show that although desmin, MyoD, pRB, and M-cadherin are reduced and Myf-5 is increased in the absence of A-type lamins, other myogenic factors such as Pax3, Pax7, MEF2C, MEF2D, c-met, and beta-catenin are not affected, indicating that A-type lamins have a specific effect on a subset of myogenic components. While the consequence of decreased pRB and M-cadherin protein levels remains to be determined, it seems unlikely that decreased pRB levels alone underlie the common differentiation defects seen in response to lamin A/C deficiencies, because pRB levels are not reduced in response to either Lmna- or Emd-RNAi yet differentiation is compromised. That pRB may, however, play a role in the reduced differentiation of Lmna–/– myoblasts would be compatible with the known interactions of pRB and MyoD with histone deacetylase HDAC1 (Puri et al. 2001Go). Further evidence consistent with compromised function of pRB and MyoD pathways is provided by recent gene expression profiling studies of EDMDs and characterization of the emerin-null mouse (Bakay et al. 2006Go; Melcon et al. 2006Go).


Figure 7
View larger version (60K):
[in this window]
[in a new window]
 
Figure 7. Reducing protein levels of emerin impairs muscle differentiation. (A) Lmna+/+ myoblasts with retrovirally transduced Emd-RNAi exhibit greatly reduced emerin protein as well as reductions in MyoD and desmin, but not pRB. (B) Clonal analysis indicates that few highly differentiated muscle clones are formed by Lmna+/+ muscle cells expressing Emd-RNAi compared with Lmna+/+ EGFP-RNAi control muscle cells. Approximately 120 clones were scored per time point. (C) Western analysis indicating the expression of MyoD-ER in Lmna+/+ Emd-RNAi myoblasts. (D) Clonal analysis of Lmna+/+ Emd-RNAi cells. Increased numbers of well-differentiated clones appear when MyoD-ER is expressed, and cells are differentiated in the presence of beta-estradiol. Approximately 100 clones were scored per time point.

 
Reintroduction of lamin A protein is sufficient to rescue the differentiation defects in myoblasts with an siRNA-mediated reduction of A-type lamins, but insufficient to rescue differentiation in Lmna–/– myoblasts. What underlies this surprising difference? We cannot categorically rule out a model whereby other events have occurred either during the generation of Lmna–/– mice or the permanent myoblast cell lines, which further impair in vitro myogenesis. However, we think it unlikely that impaired differentiation kinetics of myoblasts lacking lamin A/C are due to the "differentiation-defective" phenotype that commonly appears in permanent myogenic cell lines (Lim and Hauschka 1984Go). The strongest evidence against this possibility is that the RNAi-transduced Lmna+/+ myoblasts were subjected to clonal assays within only 4 d of retroviral transduction, and yet ~50% of the cells generated poorly differentiated clones (<30% MyHC+ cells) while ~95% of the control population generated well-differentiated clones. Since differentiation-defective myoblasts arise at frequencies well below 0.1% and take months of continuous passage to accumulate to substantial numbers (Lim and Hauschka 1984Go), 50% of the Lmna-RNAi population could not have acquired the classic muscle culture differentiation-defective phenotype within 4 d. Additional evidence that the impaired differentiation of Lmna–/– myoblasts is not due to the classical differentiation-defective phenotype is that "standard" differentiation-defective muscle cells exhibit normal levels of lamin A/C but do not express Pax 7 (R.L. Frock, S.D. Hauschka, and B.K. Kennedy, unpubl.), whereas Lmna–/– myoblasts lack lamin A/C and express Pax7. The low differentiation potential of Lmna–/– myoblasts thus seems to result directly from a lamin A/C deficiency.

The individual Lmna–/– muscle cells (Fig. 1I) and the small fraction of Lmna–/– myogenic clones that exhibit high levels of muscle differentiation (Fig. 2B) raise a paradoxical and as yet unanswered question. Why are some cells able to differentiate while most others are not, when none of the cells contain lamin A/C? The most likely explanation would seem to be that at least one of the molecular processes responsible for committing cells to terminal differentiation is stochastic (Wright 1984Go), and that lamin A/C levels affect the probability of cell commitment. Clearly, what appears as ostensibly normal muscle differentiation does not require lamin A/C, but the functional levels of A-type lamins appear to influence the commitment probability. In the presence of normal lamin A/C levels, virtually all Lmna+/+ muscle colonies differentiate; however, the percentage of differentiated cells differs from colony to colony with no colonies containing 100% differentiated cells. Furthermore, the percentage of differentiated cells increases with time (Fig. 1C,D,F,H). Consequently, while overall environmental conditions (e.g., low growth factor levels) may be permissive for differentiation, satellite cell-derived myoblasts have the option of entering additional rounds of DNA synthesis prior to differentiating, and a small percentage become quiescent without differentiating (Angello and Hauschka 1996Go).

Lmna+/– and Lmna-RNAi Lmna+/+ muscle cells have progressively lower levels of lamin A/C, and they exhibit progressively lower probabilities of differentiating (Fig. 1C). This may be partially attributable to the lower levels of MyoD in such cells (Fig. 3A). However, when individual Lmna+/+ and Lmna–/– myoblasts are immunostained for MyoD (Fig. 4), Lmna+/+ cells exhibit strong to medium staining intensities, whereas Lmna–/– myoblasts exhibit MyoD staining intensities ranging from ~40% that exhibit virtually no staining to many that exhibit staining intensities equivalent to those seen in Lmna+/+ cells. Importantly, >95% of the MyoD-negative Lmna–/– myoblasts are Pax7-positive; thus while these cells exhibit compromised differentiation capabilities, they apparently retain some myogenic properties. While MyoD staining intensities cannot yet be correlated with a cell's subsequent differentiation potential, this heterogeneity could partially explain the compromised differentiation of Lmna–/– myoblasts. This possibility would be consistent with the heterogeneous behavior of normal satellite cells in which a low-level commitment to terminally differentiate is correlated with a low ratio of MyoD to Pax7 (Zammit et al. 2004Go), a phenotype that is also characteristic of some lamin A/C-deficient myoblasts (Fig. 4C,D). Interestingly, when MyoD or desmin are exogenously expressed in lamin A/C-deficient cells, their probability of differentiation returns to near normal levels. Thus MyoD, desmin, and lamin A/C seem to play critical roles in regulating at least one stochastic component of myogenic terminal differentiation.


Desmin and the EDMD phenotype

Previous in vitro cell culture data have suggested a role for desmin in myogenesis (Li et al. 1994Go; Weitzer et al. 1995Go). Although Des–/– mice develop normally (Li et al. 1996Go), they have postnatal defects in skeletal, cardiac, and smooth muscles. In addition, Des–/– myoblasts have delayed cell cycle withdrawal and delayed fusion in vivo (Agbulut et al. 2001Go; Smythe et al. 2001Go), which suggests that desmin is important for adult skeletal muscle regeneration. Our findings with lamin A/C-deficient myoblasts, showing a decrease in desmin protein and transcript, suggest phenotypic overlap between Lmna–/– and Des–/– mice. In support of this hypothesis, restoration of normal desmin levels in Lmna–/– myoblasts enhances their differentiation potential, implying that desmin is important for muscle differentiation in Lmna–/– myoblasts. This finding is particularly interesting given that desmin is a cytoplasmic intermediate filament protein not directly linked to myogenic transcription. However, vimentin and desmin intermediate filaments are known to stably associate with nuclear matrix attachment regions, where they might secondarily affect gene transcription (Tolstonog et al. 2002Go). Thus the reduced expression of desmin in Lmna–/– myoblasts could lead to compromised communication between the cytoplasm and the nuclear envelope, and this might be restored by overexpression of desmin in Lmna–/– cells. This raises the possibility that EDMD phenotypes in vivo might be offset by therapeutic approaches designed to elevate desmin levels in skeletal and cardiac muscle.


Lamin A/C, MyoD, and EDMD

Lmna–/– myoblasts and MyoD–/– primary myoblasts are remarkably similar (Sabourin et al. 1999Go), sharing many overlapping phenotypes, including delayed cell cycle withdrawal, reduced differentiation potential, and reduced desmin and M-cadherin. Unlike Lmna–/– mice, however, MyoD–/– mice do not develop a muscular dystrophy phenotype (Rudnicki et al. 1992Go). Why should populations of mutant myoblasts behave similarly in in vitro differentiation assays but differently in the organism? Interestingly, when MyoD–/– mice are challenged with acute muscle injury, they form few fully repaired fibers and the majority of the differentiated cells within the damaged area remain mononucleated. In addition, when MyoD–/– mice are interbred with mice that contain a naturally occurring loss-of-function mutation in the dystrophin gene (mdx) (Bulfield et al. 1984Go; Hoffman et al. 1987Go; Cox et al. 1993Go), they develop a more severe myopathy resulting in death at ~1 yr (Megeney et al. 1996Go). In contrast, mdx mice have a normal life span and exhibit little overt skeletal muscle weakness except in the diaphragm muscle. Thus, in mouse muscle disease models, dystrophic phenotypes are enhanced when increased degeneration (due to the absence of dystrophin or lamin A/C) is coupled with decreased regenerative potential due to the experimental removal of MyoD in mdx/MyoD–/– mice and the possible decrease of MyoD in Lmna–/– mouse satellite cells in vivo. A further complication is that Myf-5 protein levels are substantially increased in Lmna–/– myoblasts (Fig. 3A), and yet, the increased level of this highly related transcription factor does not compensate for the decreased level of MyoD.

Two models have been proposed to explain dystrophic syndromes of muscle resulting from LMNA mutation. One "structural weakness" model proposes that LMNA mutant myoblasts exhibit reduced cellular integrity and therefore enhanced tissue degeneration. Indeed, cells lacking lamin A/C exhibit impaired viability under mechanical strain as well as changes in expression of mechanosensitive genes (Broers et al. 2004Go; Lammerding et al. 2004Go). The "impaired differentiation" model proposes that tissue regeneration may be compromised in Lmna–/– muscle due to defective maintenance of the myogenic program in satellite cells. Our in vitro findings provide compelling evidence that muscle differentiation programs are compromised in Lmna–/– myoblasts, resulting in impaired myogenic potential. This conclusion is reinforced by the finding that MyoD protein levels are decreased in myoblasts deficient for lamin A/C and emerin, and that forced expression of MyoD in such cells restores muscle differentiation. We propose that both "structural weakness" and "impaired differentiation" defects contribute to muscular dystrophy in the murine Lmna–/– disease model.


    Materials and methods
 Top
 Abstract
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 

Derivation of Lmna+/+, Lmna+/–, and Lmna–/– myoblast cell lines and conditions for differentiation

Primary and permanent Lmna+/+, Lmna+/–, and Lmna–/– myoblasts were derived from 5-wk-old Lmna+/+, Lmna+/–, and Lmna–/– mouse hindlimb muscles (provided by Colin Stewart, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, MD). Hindlimb muscles were dissected in F10C medium (GIBCO) to isolate skeletal muscle and to remove adipose and connective tissues. Muscle was minced with fine scissors and digested with 375 U/mL type II collagenase (Worthington) for 1 h at 37°C and cultured as previously described (Hauschka et al. 1979Go; Neville et al. 1997Go). All cultures were grown on plates coated with 0.67% gelatin (Difco) in F10C medium supplemented with 15% preselected horse serum and fed 4 ng/mL basic fibroblast growth factor (human recombinant bFGF, Zymogenetics) every 12 h. Cells were passaged every 3 d and seeded at 5 x 104 cells per 100-mm plate continually until the spontaneously immortalized permanent line was generated. No individual muscle clones were isolated during derivation of the cell lines because we wanted the final cell populations to be maximally representative of all myogenic cells within each muscle sample. Cells in the 10–15 passage range following derivation of the permanent cell lines were used for all experiments.

Muscle cells were induced to differentiate via mitogen depletion, as described elsewhere (Clegg et al. 1987Go; Neville et al. 1997Go). Briefly, proliferating myoblasts are rinsed in saline G to remove residual bFGF before adding F10C supplemented with 1.5% horse serum and 1 µM insulin. For the clonal analysis of myogenesis (Clegg et al. 1987Go), Lmna muscle clones were switched to low mitogen media as above, but after 4 d, the cultures were switched back to F10C medium containing 15% horse serum and 1µM insulin for the duration of the experiment. This enhances long-term culture survival without stimulating cell replication, since bFGF is not present.


Differentiation and proliferation assays, immunohistochemistry, and Western blotting

To measure muscle differentiation, cells were fixed in alcohol–formalin–acetic acid (AFA); immunostained for MyHC using monoclonal MF-20 diluted 1:100 (gift from D.A. Fischman, Cornell University Medical College, New York), plus biotinylated rabbit anti-mouse IgG, streptavidin, and biotinylated horseradish peroxidase (Vector Labs, Inc.); and counterstained with 1% methylene blue or hematoxylin. For detecting S-phase cells, cultures were pulsed with BrdU (Amersham; 2 µL/mL of media) for 1 h prior to fixation as described elsewhere (Foster et al. 1987Go) and subsequent immunostaining using anti-BrdU diluted at 1: 2000 (G3G4; gift from Steve Kaufman, University of Illinois, Urbana) and MF-20 diluted at 1:100 using isotype-specific secondary immunofluorescent antibodies (Molecular Probes). For high-resolution optical sectioning of myoblasts using the Zeiss axiovert 200M, cells were plated on 1- to 2-mm round glass coverslips (Fisher) that had been prepared by incubating 12–24 h in 1 M magnesium acetate, rinsed twice with PBS, then incubated for 1 h in 25 µg/mL poly-L-lysine (ICN Biomedicals), and finally incubated 3–24 h in 5 µg/mL laminin (Sigma). After plating, cells were fixed as described elsewhere (Kennedy et al. 2000Go; Barbie et al. 2004Go) and immunostained with the following antibodies: MyoD diluted at 1:500 (M-318; Santa Cruz), desmin diluted at 1:200 (clone D33; DAKO), and Pax7 diluted at 1:200 (developed by Atsushi Kawakami [University of Tokyo, Tokyo, Japan] and obtained from the Developmental Studies Hybridoma Bank, University of Iowa).

Muscle cells were lysed in RIPA buffer (50 mM Tris-HCl at pH 7.4, 150 mM NaCl, 1% NP-40, 0.25% deoxycholate) supplemented with phosphatase and protease inhibitors (1 mM Na3VO4, 1 mM NaF, 1 mM PMSF, 1 mM EDTA, 1 µg/mL aprotinin, 1 µg/mL leupeptin). Western analysis of muscle cell lysates was performed using standard procedures. The following antibodies were used: lamin A/C diluted at 1:1000 (2032; Cell Signaling), MyoD diluted at 1:100 (clone 5.8A; gift from Peter Houghton and Peter Diaz, St. Jude Children's Hospital, Memphis, TN), MyoD diluted at 1:100 (M-318; Santa Cruz), Myf-5 diluted at 1:100 (C-20; Santa Cruz), MEF2C diluted at 1:200 (9792; Cell Signaling), MEF2D diluted at 1:200 (clone 9; BD), pRB diluted at 1:100 (clone G3-245; BD), desmin diluted at 1:20 (clone D3; gift from D.A. Fischman, Cornell University Medical College), desmin diluted at 1:10,000 (ab15200; abcam), Pax3 diluted at 1:200 (gift from J.A. Epstein, Cardiovascular Division, University of Pennsylvania, Philadelphia, PA), Pax7 diluted at 1:50 (obtained from the Developmental Studies Hybridoma Bank, University of Iowa), beta-catenin diluted at 1:1000 (H-102; Santa Cruz), emerin diluted at 1:1000 (FL-254; Santa Cruz), M-cadherin diluted at 1:300 (clone 5; BD), c-met diluted at 1:1000 (SP260; Santa Cruz), pan-actin diluted at 1:10,000 (clone C4; Chemicon), and beta-actin diluted at 1:10,000 (clone ab8226; abcam).


Retroviral constructs and transduction

293T cells were acquired from ATCC and were cultured in DMEM supplemented with 10% fetal calf serum. RNAi constructs for mouse lamin A/C, mouse emerin, and enhanced green fluorescent protein (EGFP) were cloned into pSuper.retro-Puro as described elsewhere (Kudlow et al. 2005Go). Lamin A-SiR was generated by site-directed mutagenesis of a wild-type human lamin A cDNA using an oligonucleotide with the following sequence: GCAGACCATGAAGGAGGAGCTCGATTTTC AAAAGAATATCTACAGTGAGGAGCTGCG. The mutated lamin A cDNA was sequence-verified and subcloned into pMXIH for high-level, retroviral expression (Kudlow et al. 2005Go) as was wild-type lamin A. Both wild-type lamin A and lamin A-SiR were expressed as prelamin A (including the 18 amino acids that are eventually cleaved) so as to be processed naturally by the target cells. Desmin (IMAGE 4219280) was cloned into pMSCV-puro (Clontech) using BglII and EcoRI and was sequence-verified. pBABE- and pLXSH-MyoD-ER plasmids were gifts from Stephen J. Tapscott (Fred Hutchison Cancer Research Center, Seattle, WA). All retroviral constructs were transiently cotransfected into 293T cells with an ecotrophic packaging plasmid to generate nonreduplicating retroviruses. Viral supernatants from the 293T cells were filtered through 0.45-µm syringe filters (Millipore), added to exponentially growing Lmna muscle cultures (~200,000 cells per 100-mm plate), and supplemented with 4 ng/mL polybrene (Sigma). Lmna muscle cultures were retrovirally transduced either in F10C supplemented with 15% horse serum or at 1:1 ratios of 15% horse serum F10C and 10% fetal calf serum DMEM and fed 12 ng/mL bFGF for the duration of the retroviral infection. Selection for puromycin- or hygromycin-resistant myoblasts occurred after 24–36 h post-infection using 10 µg/mL and 300 µg/mL concentrations, respectively. Differentiation of MyoD-ER-Lmna–/– myoblasts and MyoD-ER-EmdRNAi Lmna+/+ myoblasts was achieved by addition of 0.1 µM beta-estradiol (Sigma) following a standard medium switch (see above) to differentiation media.


QPCR

mRNA's were purified using the RNeasy kit (Qiagen). Samples were DNase I-treated, and cDNA was generated using reverse transcriptase (Promega) and oligo dT15 primers (Invitrogen). For QPCR, 10 µL of 2x master mix containing SYBR Green (Applied Biosystems) was mixed with cDNA and 300 µM forward and reverse primers. Triplicates of the cDNA's were amplified on the Opticon I real-time thermal cycler (MJ Research). The experiments were performed three times at three different cDNA dilutions. PCR products were normalized against the housekeeping gene Hprt, and measurements between samples were compared by cycle threshold (Ct).

Primer sequences used for QPCR are the following: Hprt (GenBank J00423 [GenBank] ) forward, 5'-AGGACCTCTCGAAGTGTT GG-3'; Hprt reverse, 5'-TGGCAACATCAACAGGACTC-3'; RB (GenBank NM_009029 [GenBank] ) forward, 5'-TACACTCTGTGCAC GCCTTC-3'; RB reverse, 5'-TCACCTTGCAGATGCCATAC -3'; MyoD (GenBank X61655 [GenBank] ) forward, 5'-CATCCGCTACATC GAAGGTC-3'; MyoD reverse, 5'-TAGTAGGCGGTGTCGTA GCC-3'; desmin (GenBank BC031760 [GenBank] ) forward, 5'-TACACCT GCGAGATTGATGC-3'; and desmin reverse, 5'-ACATCCAA GGCCATCTTCAC-3'.


    Acknowledgments
 Top
 Abstract
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
We are grateful to Colin Stewart and Teresa Sullivan for providing Lmna mouse muscle tissue. We thank John Angello, Lindus Conlan, Erica Smith, Rob Welikson, and other members of the Hauschka and Kennedy Laboratories for helpful comments and suggestions. We also thank Joyce Hong, Bharti Sharma, and Nayan Arora for their help in maintaining and generating tissue culture reagents and performing MyHC staining, and Linnea Welton for technical assistance. B.A.K. is supported in part by PHS NRSA T32 GM07270 from NIGMS. This work was supported by the National Institutes of Health grant R01AG024287 to B.K.K., and by grants RO1AR18860 and 1PO1 NS046788 to S.D.H. B.K.K. is a Searle Scholar.


    Footnotes
 
Article and publication are at http://www.genesdev.org/cgi/doi/10.1101/gad.1364906.

Corresponding authors.

3 Members of the Hauschka and Kennedy groups contributed equally to these studies. Back

4 E-MAIL haus{at}u.washington.edu; FAX (206) 685-1792. Back

5 E-MAIL bkenn{at}u.washingon.edu; FAX (206) 685-1792. Back


    References
 Top
 Abstract
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Agbulut, O., Li, Z., Perie, S., Ludosky, M.A., Paulin, D., Cartaud,