![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
1 Lineberger Comprehensive Cancer Center, 2 Curriculum in Genetics and Molecular Biology 3 Department of Biochemistry and Biophysics, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599, USA
 |
Abstract |
|---|
 Top Abstract ResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
[Keywords: DNA repair; V(D)J recombination; double-strand break repair; transposition]
Received March 22, 2006; revised version accepted April 19, 2006.
). RAG proteins use a transposase-like mechanism to cleave chromosomal DNA at recombination signals (van Gent et al. 1996). Importantly, the signal end fragment excised by RAG protein cleavage activity can also be likened to a transposon. It has been demonstrated that RAG proteins can direct the integration of this fragment into DNA targets approximately at random (e.g., Fig. 1A) in vitro (Agrawal et al. 1998; Hiom et al. 1998), in yeast cells (Clatworthy et al. 2003), and even in mammalian cells (Chatterji et al. 2006).
|
; Raghavan et al. 2004). With respect to transposition activity, for example, it has been suggested that RAG proteins could initiate recombination at a site within a receptor locus, but then "transpose" one end of the receptor locus double-strand break into a target site near an oncogene (one-ended transposition) (Hiom et al. 1998).
However, whether V(D)J recombination-associated transposition activity could be a significant source of genomic instability is not yet clear. Studies of transposition activity in cellular contexts indicate it is infrequent (Clatworthy et al. 2003; Chatterji et al. 2006), and have been limited to measuring targeting of transposition into artificial episomes: As yet, there is only one clear example where a transposition-event targeted its host genome (Messier et al. 2003). Therefore, we address here whether or not the transposon-like fragment excised during V(D)J recombination can significantly target its host genome. Moreover, to more closely mimic V(D)J recombination in the whole animal, we used a mouse pre-B-cell line as host, and a chromosomally resident recombination substrate. The substrate was further designed to determine the frequency of genomic integration of the excised fragment as a function of each excision: This is the key measure of the danger posed by V(D)J recombination-associated transposition, as the excision step is implicit in development of each mature lymphocyte. Our results implicate V(D)J recombination-associated transposition activity as an important possible source of oncogenic rearrangements.
|
Results |
|---|
|
TopAbstractResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
The temperature-sensitive Abelson Murine Leukemia virus (ts-AMuLV) line used as a host can be induced in culture to undergo multiple developmental steps analogous to the in vivo transition from pre-B cells to immature B cells (Muljo and Schlissel 2003), including initiation of V(D)J recombination at its endogenous immunoglobulin 
(Ig) light-chain locus (Chen et al. 1994). Three different recombination substrate-containing clones were generated from the initial ts-AMuLV line, and multiple experiments were performed with each clone. We were unable to detect any significant differences between different clones or experiments in our current sample; thus, only the pooled results are discussed (see Table 1; Materials and Methods for differences in clones and experimental conditions). In total, 21 subclones were identified that had reintegrated the putative transposon, from a total of 2.2 x 107 cells screened (Table 1). Parallel assessments of cells resistant only to puromycin determined that 2.8 x 105 of the screened cells had undergone productive V(D)J recombination. The transposon-like fragment associated with V(D)J recombination thus reintegrates into the genome approximately once every 1.3 x 104 recombinations.
|
; Clatworthy et al. 2003; Tsai et al. 2003; Chatterji et al. 2006). Target sites were otherwise distributed throughout the genome, although, interestingly, two of the six transpositions (integrations #5 and #6) (Fig. 2A) were located within a region of GC-rich pentanucleotide repeats (Sµ repeat region) that targets immunoglobulin H (IgH) isotype switch recombination. Southern blotting indicated there were no rearrangements of the Sµ region in the other induced subclones, arguing switch recombination is not highly active in this pre-B-cell line (Y.V.R. Reddy and D.A. Ramsden, unpubl.). It is tempting to speculate instead that the richness of secondary structure-forming sequences in this region (e.g., G quartets, hairpins) (Gellert et al. 1962; Tashiro et al. 2001) might make this region a transposition "hot spot" (see also integration #7, below).
|
|
100-bp (CA)N–(TG)N inverted repeat. Hairpins that form at inverted repeat sequences are preferred targets for RAG-mediated transposition in vitro (Lee et al. 2002), and hairpin-targeted transposition might partly explain a complex rearrangement recovered from human cells (Messier et al. 2003). Additionally, RAG proteins can mediate a reversal of the initial cleavage reaction by inserting signal ends into hairpin coding end intermediates in vitro (Melek et al. 1998), and, under certain conditions, in vivo (Bogue et al. 1997; Sekiguchi et al. 2001). However, the presence of a target site duplication cannot be used to identify this type of event as a transposition, and inverted repeat sequences are generally associated with chromosome breakage.
|
|
).
|
|
or IgH signal end of the opposite type, generating a precise 12-RS/23-RS-type signal junction. The remaining signal end of the zeorGFP fragment was imprecisely joined to a Ig/IgH coding end. These integrations can be attributed to intermolecular recombination. The RAG proteins mistakenly juxtaposed a signal from the Ig or IgH locus with a signal of opposite type from the zeorGFP fragment (intermolecular synapsis) (Fig. 5B), triggering cleavage at the Ig/IgH signal. The zeorGFP signal may have been part of a signal junction circle that is recleaved as a consequence of the intermolecular synapsis (as shown in Fig. 5B), as there is precedent for secondary recombinations involving a signal within a signal junction (Lewis et al. 1985). However, we cannot exclude the possibility that signal junction fomation is unnecessary, and a zeorGFP signal end participated in synapsis with, and triggered cleavage of, the IgH signal. In any event, integration is the consequence of the subsequent resolution of all four broken ends by NHEJ, as described in Figure 5B. Importantly, the intermolecular recombinations described here can be likened to those that occur between a signal within an antigen receptor locus and a cryptic signal within an oncogene locus (Fig. 5C), leading to a subset of cancer-causing translocations. In both cases, the critical aberrant step is the inappropriate intermolecular synapsis of signals by RAG proteins.
Seven other examples also involve targeting of integration to Ig loci (Fig. 6A). However, only one of the 14 junctions from these integrations involves two signals (integration #21), and joining was never precise (numbers of nucleotides deleted from Ig ends are noted in parentheses in Fig. 6A). Instead, zeorGFP signal ends were often perfectly retained and usually joined to ends of Ig coding segments (coding ends) with short deletions, a pattern consistent with previous examples of NHEJ-dependent joining of comparable ends (Sekiguchi et al. 2001). Broken intermediates from a single V(D)J recombination event are normally joined by NHEJ to each other (joining in cis): In these seven events, joining in cis apparently failed, both for the signal end intermediates from recombination at the substrate locus, as well as for the intermediates from an independent recombination occurring in parallel within the Ig locus. Instead, the intermediates from these two independent recombinations were joined to each other in trans (Fig. 6B). Such events are comparable to oncogenic "end donations," where intermediates from an antigen receptor recombination are joined to the ends of a double-strand break generated independently within an oncogene locus (Fig. 6C). The critical aberrant step in both examples is the failure of NHEJ to join broken ends in cis, leading instead to inappropriate joining of broken ends in trans.
|
Discussion |
|---|
|
TopAbstractResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
) best reconciled with oncogenic translocations (e.g., one-ended transpositions, cycles of integration, and excision). Indeed, these alternate transposition pathways were initially proposed because they can generate aberrant rearrangement structures that are mostly indistinguishable from those previously attributed to end donation. Therefore, with respect to the oncogenic potential of transposition, we consider it noteworthy that at least when transpositions can be definitively identified, transposition competes effectively with the two pathways previously used to explain oncogenic translocation. Perhaps more importantly, transposition was the primary means (7/11 events) by which signal end intermediates were resolved in a near-random, and thus potentially oncogenic, manner. In contrast, the probable intermolecular recombinations and end donations we recovered were mostly targeted to a recombining locus, and consequently made "safe."
Several characteristics of our assay argue for its biological relevance. The use of a substrate where the transposon donor was chromosomally integrated was probably critical. It has not been possible to recover transpositions in cellular genomes from an episome-based donor, and transposition between episomes appears to be much less efficient (Chatterji et al. 2006). Additionally, we used a cell line of lymphocyte lineage, and consequently native RAG1 and RAG2 proteins, expressed under native transcriptional control. As noted above, concurrent recombination activity at Ig loci also led to other biologically relevant aberrant resolutions, allowing us to assess how well transposition competes with such events. Recombination activity was also not excessive, as 15% of light chain loci (and 3% of substrate loci) recombined in the 24-h period during which recombination was active. Nevertheless, transposition frequencies in a whole animal could still be significantly different. For example, we might be overestimating transposition in vivo due to characteristics of this transformed cell line model (e.g., probable disruption of DNA damage checkpoints). Alternatively, our assay might underestimate transposition in vivo, as it is unlikely we recover all integrations (the ability to express sufficient zeorGFP to survive selection is probably highly dependent on integration context).
Is V(D)J recombination-associated transposition an important threat to genomic integrity? At least under conditions where transpositions can be definitively identified, we show it accounts for a high proportion of aberrant V(D)J recombinations. We estimate there are 2.5 x 10–5 events associated with each V(D)J recombination. For comparison, the well-characterized sleeping beauty transposon, which has been engineered to mutagenize the mouse genome, transposes in embryonic stem cells with similar or lower frequency (3.5 x 10–5 to 2 x 10–7 events/cell/generation) (Luo et al. 1998). Humans generate several hundred million new lymphocytes/day, with each new lymphocyte requiring at least three V(D)J recombination events. Our data would thus suggest this daily output of lymphocytes is accompanied by as many as 10,000 transpositions: in all liklihood, an important potential source of oncogenic genome rearrangements.
|
Materials and methods |
|---|
|
TopAbstractResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
The substrate was derived from amplified fragments of pPUR and pTRACER-EF plasmids (Clontech), and assembled as described in Figure 1 within a murine stem cell virus-based retrovirus vector (Cheng et al. 1998). Diversity in coding junction formation could potentially lead to infrequent puromycin resistance, reducing the sensitivity of our assay. Therefore, since NHEJ often precisely deletes repeated sequence at ends during coding junction formation, we designed the substrate such that the 4 bp of the puromycin coding sequence immediately flanking recombination signals was repeated. Sequencing of coding junctions formed in the absence of selection indicated the puromycin ORF was precisely assembled in three out of five V(D)J recombinations.
Retrovirus was prepared by cotransfection of the substrate plasmid together with plasmids expressing gag, pol, and vsv-g genes into 293T cells (Pear et al. 1993). Virus recovered from the supernatant was used to infect the ts-AMuLV line SP-9 (gift of Y. Chang, University of New Mexico, Albuquerque, NM) (Chang and Brown 1999). Clones were obtained by limiting dilution plating in media with 100 µg/mL zeocin, and those with unique, single-copy integrations were identified by Southern blotting of genomic DNA from zeor colonies. The construct used to generate clones A and B possessed a deletion of 1 nucleotide (nt) within the 23-RS nonconserved spacer. This is within the ±1-bp natural variation of spacer size used in vivo; thus, we continued study of lines made with this construct, but additionally corrected the substrate and generated a line with a consensus spacer size 23-RS (Clone C). The integrated version of the substrate in Clone A also has a 400-bp deletion between the 12-bp spacer RS and zeorGFP reading frame that apparently had no significant impact on zeorGFP expression.
Screening colonies
Cells were washed once and V(D)J recombination induced in the absence of both puromycin and zeocin by transfer to 40°C for 24 h. Induced cultures were then returned to preinduction conditions to recover for 24 h, still without antibiotics. Cells were then subcloned by plating in 96-well plates at 2 x 103 cells/plate in media with 5 µg/mL puromycin alone [to determine the frequency of productive V(D)J recombination], or at 105 cells/plate in 5 µg/mL puromycin and 100 µg/mL zeocin. Screening by flow analysis indicated a small proportion of subclones that survived in zeocin nevertheless had green fluorescence indistinguishable from background (within 10% of the median fluorescence intensity of the parental line). This indicates cells can infrequently acquire zeocin resistance by means other than maintenance of the zeorGFP cassette: Later analysis of DNA from selected zeor, GFP negative clones by PCR (Supplementary Fig. 3A, P4/P7) confirmed the absence of the zeorGFP cassette. DNA was prepared from the remaining clones and analyzed by PCR to confirm coding junction formation (assembly of a complete puromoycin gene) (Supplementary Fig. 3A, P2/P9), as well as loss of the "germline" 5' puro fragment–recombination signal–zeorGFP configuration (Supplementary Fig. 3A, P2/P5).
The majority of puror–zeor clones were eliminated from further analysis when they tested positive for both coding junction and "germline" PCR products. Southern analysis of selected clones of this type determined this was due to apparent duplication of the substrate in an estimated 1% of the parental line prior to induction of recombination: Upon induction of recombination in these cells, one copy recombined, conferring puromycin resistance to the cell, while the remaining copy remained in the unrecombined configuration, allowing the cell to also retain resistance to zeocin. Such duplications may have been caused by mobilization of our proviral substrate by a helper virus in trans, or possibly unequal sister chromaid exchange at proviral long terminal repeats.
The 21 puror–zeor subclones remaining after screening by PCR analysis were then analyzed by Southern blotting, and confirmed to have a pattern consistent with transposition; that is, relative to the clone before recombination, a 5' puro hybridizing species showed evidence of transposon excision (2 kb smaller) (Fig. 1B; Supplementary Fig. 1A,C,E), while zeorGFP hybridizing species were of a distinct size, but varied essentially at random (Fig. 1C; Supplementary Fig. 1B,D,F). ZeorGFP (543 bp) and Puro (423 bp) probe fragments for Southern blot analysis were generated by PCR amplification of substrate with primer pairs P3/P8 and P1/P6, respectively (Supplementary Fig. 3). Each probe fragment was radiolabeled with 
32P-dCTP by two rounds of annealing with appropriate primers and extension with klenow polymerase. Hybridizations were performed in buffer with 50% formamide at 43°C for the zeorGFP probe and 49°C for the Puromycin probe using standard protocols.
In vitro transposition
The in vitro transposition reactions were performed as previously described, using the same oligonucleotide recombination signals and PCR primers (Lee et al. 2002), except we used as target plasmid cloned chromosomal sequences that acted as cellular targets for integrations #7 and #8. Briefly, a complex of recombinant core RAG1 and RAG2 proteins, HMG1, and oligonucleotide recombination signals was first formed by preincubation in the presence of CaCl2. Cleavage of recombination signals and transposition was then initiated by addition of MgCl2 and 0.8 µg of plasmid target. Integrations of cleaved signals were then PCR-amplified from deproteinized reactions using a primer in the recombination signal and a primer in the plasmid target. Target plasmid carried through the transposition and PCR reactions was then inactivated by digestion with DpnI before PCR products were cloned (TOPO-TA, Invitrogen). Consistent with integration by a transposition mechanism, we recovered only integrations of accurately cleaved recombination signals, despite using oligonucleotide signals with flanking "coding" sequence.
Characterization of junctions
Junction sequences were cloned by inverse PCR. Briefly, genomic DNA was first enriched for fragments with integrations by separating EcoRI-digested genomic DNA by electrophoresis on a 0.8% agarose gel, followed by recovery of DNA of molecular weight appropriate to species with integrations as determined by prior Southern analysis. This DNA was then digested with HaeIII or MspI, ligated with T4-DNA ligase at 0.25–0.5 µg/mL, amplified by 25 cycles using the 12R1/12F1 and 23F1/23R1 primer pairs (Supplementary Fig. 3B), diluted 50-fold, and amplified again for 25 cycles with 12R2/12F2 and 23F2/23R2 (Supplementary Fig. 3B). PCR products were then cloned using a TOPO-TA cloning kit (Invitrogen) and sequenced. We then used the sequences derived from inverse PCR to design primers that permitted direct amplification of integration junctions.
PCR primers
The following primers were used for PCR amplifications; their approximate position within our substrate is noted in Supplementary Figure 3: (5'–3') P1, CCAGCCGGGAACCGCTCAA CT; P2, CGAGCTGCAAGAACTCTTCCTCAC; P3, CTCCAA TTGGCGATGGCCCTGTCC; P4, GGTCACGCTTTTCGTT GGGATCTTTCG; P5, TACTCAGACAATGCGATGGG; P6, GAATTCTAGGCTTTTGCAAAAAGCTT; P7, AGATGACG GGAACTCCAAGACGC; P8, ATAAACAAGTTTCGAGGTC GAGTGTCAGTC; P9, CGCTCGTAGAAGGGGAGGTT; 12R1, GCCAGGCGGGCCATTTACCGTA; 12R2, TACTCAGACAA TGCGATGGG; 12R3, GAAATCCCCGTGAGTCAAAC; 12F1, GACGCAAATGGGCGGTAGGC; 12F2, GTACGGTGGGAG GTCTATAT; 23R1, GTAACCATTATAAGCTGCAATAAAC; 23R2, GAGGTCGAGTGTCAGTCCTGC; 23F1, TCACTGCA TTCTAGTTGTGGTTTG; 23F2, GTGGTTTGTCCAAACTC ATCAATG.
PCR reactions using P2/P9 required inclusion of 1 M betaine (Sigma).
|
Acknowledgments |
|---|
|
TopAbstractResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
|
Footnotes |
|---|
EMAIL dale_ramsden{at}med.unc.edu; FAX (919) 966-3015.
Supplemental material is available at http://www.genesdev.org.
Article is online at http://www.genesdev.org/cgi/doi/10.1101/gad.1432706
|
References |
|---|
|
TopAbstractResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
Bogue M.A., Wang C., Zhu C., Roth D.B. 1997. V(D)J recombination in Ku86-deficient mice: Distinct effects on coding, signal, and hybrid joint formation. Immunity 7: 37–47.[CrossRef][Medline]
Chang Y. and Brown M.L. 1999. Formation of coding joints in V(D)J recombination-inducible severe combined immune deficient pre-B cell lines. Proc. Natl. Acad. Sci. 96: 191–196.
Chatterji M., Tsai C.L., Schatz D.G. 2006. Mobilization of RAG-generated signal ends by transposition and insertion in vivo. Mol. Cell. Biol. 26: 1558–1568.
Chen Y.Y., Wang L.C., Huang M.S., Rosenberg N. 1994. An active v-abl protein tyrosine kinase blocks immunoglobulin light-chain gene rearrangement. Genes & Dev. 8: 688–697.
Cheng L., Du C., Lavau C., Chen S., Tong J., Chen B.P., Scollay R., Hawley R.G., Hill B. 1998. Sustained gene expression in retrovirally transduced, engrafting human hematopoietic stem cells and their lympho-myeloid progeny. Blood 92: 83–92.
Clatworthy A.E., Valencia M.A., Haber J.E., Oettinger M.A. 2003. V(D)J recombination and RAG-mediated transposition in yeast. Mol. Cell 12: 489–499.[CrossRef][Medline]
Gellert M. 2002. V(D)J recombination: RAG proteins, repair factors, and regulation. Annu. Rev. Biochem. 71: 101–132.[CrossRef][Medline]
Gellert M., Lipsett M.N., Davies D.R. 1962. Helix formation by guanylic acid. Proc. Natl. Acad. Sci. 48: 2013–2018.
Hiom K., Melek M., Gellert M. 1998. DNA transposition by the RAG1 and RAG2 proteins: A possible source of oncogenic translocations. Cell 94: 463–470.[CrossRef][Medline]
Lee G.S., Neiditch M.B., Sinden R.R., Roth D.B. 2002. Targeted transposition by the V(D)J recombinase. Mol. Cell. Biol. 22: 2068–2077.
Lewis S., Gifford A., Baltimore D. 1985. DNA elements are asymmetrically joined during the site-specific recombination of immunoglobulin genes. Science 228: 677–685.
–Luo G., Ivics Z., Izsvak Z., Bradley A. 1998. Chromosomal transposition of a Tc1/mariner-like element in mouse embryonic stem cells. Proc. Natl. Acad. Sci. 95: 10769–10773.
Marcu K.B., Banerji J., Penncavage N.A., Lang R., Arnheim N. 1980. 5' Flanking region of immunoglobulin heavy chain constant region genes displays length heterogeneity in germlines of inbred mouse strains. Cell 22: 187–196.[CrossRef][Medline]
Melek M., Gellert M., van Gent D.C. 1998. Rejoining of DNA by the RAG1 and RAG2 proteins. Science 280: 301–303.
Messier T.L., O’Neill J.P., Hou S.M., Nicklas J.A., Finette B.A. 2003. In vivo transposition mediated by V(D)J recombinase in human T lymphocytes. EMBO J. 22: 1381–1388.[CrossRef][Medline]
Muljo S.A. and Schlissel M.S. 2003. A small molecule Abl kinase inhibitor induces differentiation of Abelson virus-transformed pre-B cell lines. Nat. Immunol. 4: 31–37.[CrossRef][Medline]
Pear W.S., Nolan G.P., Scott M.L., Baltimore D. 1993. Production of high-titer helper-free retroviruses by transient transfection. Proc. Natl. Acad. Sci. 90: 8392–8396.
Raghavan S.C., Swanson P.C., Wu X., Hsieh C.L., Lieber M.R. 2004. A non-B-DNA structure at the Bcl-2 major breakpoint region is cleaved by the RAG complex. Nature 428: 88–93.[CrossRef][Medline]
Roth D.B. 2003. Restraining the V(D)J recombinase. Nat. Rev. Immunol. 3: 656–666.[CrossRef][Medline]
Sekiguchi J.A., Whitlow S., Alt F.W. 2001. Increased accumulation of hybrid V(D)J joins in cells expressing truncated versus full-length RAGs. Mol. Cell 8: 1383–1390.[CrossRef][Medline]
Tashiro J., Kinoshita K., Honjo T. 2001. Palindromic but not G-rich sequences are targets of class switch recombination. Int. Immunol. 13: 495–505.
Tsai C.L., Chatterji M., Schatz D.G. 2003. DNA mismatches and GC-rich motifs target transposition by the RAG1/RAG2 transposase. Nucleic Acids Res. 31: 6180–6190.
van Gent D.C., Mizuuchi K., Gellert M. 1996. Similarities between initiation of V(D)J recombination and retroviral integration. Science 271: 1592–1594.[Abstract]
Related Article
CiteULike 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
Genes & Dev. 2006 20: 1539-1544.
This article has been cited by other articles:
|
|
 |
|
  C. P. Lu, J. E. Posey, and D. B. Roth Understanding how the V(D)J recombinase catalyzes transesterification: distinctions between DNA cleavage and transposition Nucleic Acids Res., May 1, 2008; 36(9): 2864 - 2873. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Zhang and P. C. Swanson V(D)J Recombinase Binding and Cleavage of Cryptic Recombination Signal Sequences Identified from Lymphoid Malignancies J. Biol. Chem., March 14, 2008; 283(11): 6717 - 6727. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Nishihara, F. Nagawa, T. Imai, and H. Sakano RAG-Heptamer Interaction in the Synaptic Complex Is a Crucial Biochemical Checkpoint for the 12/23 Recombination Rule J. Biol. Chem., February 22, 2008; 283(8): 4877 - 4885. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Cui and K. Meek Linking double-stranded DNA breaks to the recombination activating gene complex directs repair to the nonhomologous end-joining pathway PNAS, October 23, 2007; 104(43): 17046 - 17051. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. Curry, D. Schulz, C. J. Guidos, J. S. Danska, L. Nutter, A. Nussenzweig, and M. S. Schlissel Chromosomal reinsertion of broken RSS ends during T cell development J. Exp. Med., October 1, 2007; 204(10): 2293 - 2303. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Mizuuchi, P. A. Rice, S. J. Wardle, D. B. Haniford, and K. Mizuuchi Control of transposase activity within a transpososome by the configuration of the flanking DNA segment of the transposon PNAS, September 11, 2007; 104(37): 14622 - 14627. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Roberts and D. A. Ramsden Loading of the Nonhomologous End Joining Factor, Ku, on Protein-occluded DNA Ends J. Biol. Chem., April 6, 2007; 282(14): 10605 - 10613. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RS 12/23), the chromosome where the fragment integrated (Ch.), a brief description of genomic DNA immediately flanking 12-RS ends and 23-RS ends, and the amount of genomic DNA between integration flanks (
