QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Supplemental Research Data Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Shin, M. Articles by Choy, H. E. Search for Related Content PubMed PubMed Citation Articles by Shin, M. Articles by Choy, H. E. Social Bookmarking                   What's this?

RESEARCH PAPER

DNA looping-mediated repression by histone-like protein H-NS: specific requirement of E⁷⁰ as a cofactor for looping

¹ Genome Research Center for Enteropathogenic Bacteria and Research Institute of Vibrio Infection, ² Department of Microbiology, Chonnam National University Medical School, Kwangju 501-746, South Korea; ³ Laboratory of Macromolecular Interactions, School of Biological Sciences and Institute of Microbiology, Seoul National University, Seoul 151-742, South Korea; ⁴ Department of Molecular and Cellular Biochemistry, Kangwon National University, School of Medicine, Chunchon, Kangwon-Do 200-701, South Korea

	Abstract

Top Abstract Results Discussion Materials and methods Acknowledgments References

 
Transcription initiation by RNA polymerase (RNP) carrying the house-keeping subunit, ⁷⁰ (E⁷⁰), is repressed by H-NS at a number of promoters including hdeABp in Escherichia coli, while initiation with RNP carrying the stationary phase , ³⁸ (E³⁸), is not. We investigated the molecular mechanism of selective repression by H-NS to identify the differences in transcription initiation by the two forms of RNPs, which show indistinguishable promoter selectivities in vitro. Using hdeABp as a model promoter, we observed with purified components that H-NS, acting at a sequence centered at -118, selectively repressed transcription by E⁷⁰. This selective repression is attributed to the differences in the interactions between hdeABp and the two forms of RNPs, since no other factor is required for the repression. We observed that the two forms of RNPs could form an open initiation complex (RP_O) at hdeABp, but that E⁷⁰ failed to initiate transcription in the presence of H-NS. Interestingly, KMnO₄ assays and high-resolution atomic force microscopy (AFM) revealed that hdeABp DNA wrapped around E⁷⁰ more tightly than around E³⁸, resulting in the potential crossing over of the DNA arms that project out of E⁷⁰ · RP_O but not out of E³⁸ · RP_O. Based on these observations, we postulated that H-NS bound at -118 laterally extends by the cooperative recruitment of H-NS molecules to the promoter-downstream sequence joined by wrapping of the DNA around E⁷⁰ · RP_O, resulting in effective sealing of the DNA loop and trapping of E⁷⁰. Such a ternary complex of H-NS · E⁷⁰ hdeABp was demonstrated by AFM. In this case, therefore, E⁷⁰ acts as a cofactor for DNA looping. Expression of this class of genes by E³⁸ in the stationary phase is not due to its promoter specificity but to the architecture of the promoter · E³⁸ complex.

[Keywords: DNA–protein interaction; E. coli; H-NS; RNA polymerase; DNA looping; transcription repression]

Received June 13, 2005; revised version accepted August 3, 2005.

H-NS, one of the most abundant DNA-binding proteins (20,000 molecules per cell) in E. coli, is implicated in global regulation of gene expression, as well as in the compact organization of the nucleoid structure (Drlica and Rouviere-Yaniv 1987; Atlung and Ingmer 1997; Deighan et al. 2003; Dorman 2004; Rimsky 2004). A recent proteome analysis has revealed that up to 5% of the genes in E. coli are down-regulated by H-NS (Hommais et al. 2001). Genes under the control of H-NS include those involved in bacterial adaptation to changes in the environment. For pathogenic bacteria, these changes are often related to the conditions encountered after invasion of mammalian hosts. H-NS has been referred to as a general transcription silencer, since it represses a large number of genes, which are not required during the exponential phase of growth under normal laboratory conditions. H-NS recognizes DNA with a certain configuration, such as curved DNA generated by stretches of AT-rich sequence (AT tracts) rather than a specific sequence (Rimsky et al. 2001; Rimsky 2004). H-NS binding (K_d) to these preferred sites, therefore, is only in the range of micromolar concentration (Fried 1989; Sonnenfield et al. 2001), not vastly stronger than to the DNA with no curvature (Lucht et al. 1994). It has been suggested that initial binding of H-NS to a preferred site is followed by lateral extension along the DNA, by oligomerization of H-NS through interactions between N-terminal domains of the protein (Dorman et al. 1999; Badaut et al. 2002; Schroder and Wagner 2002). Scanning force microscopy has shown that the preferential binding to curved DNA fragments occurs as a result of the DNA around the curve being bridged by oligomeric H-NS, which leads to the formation of a hairpin-like structure (Dame et al. 2001). The oligomerization of H-NS is, therefore, essential for preferential binding and stabilization of the multimeric nucleoprotein complex (Spurio et al. 1997). A recent study of an E. coli ribosomal gene promoter rrnB P1 has suggested that repression involves DNA looping and that the loop is closed by the association of two patches of H-NS-bound DNA in which the RNP is trapped, instead of being excluded (Schroder and Wagner 2000; Dame et al. 2002; Dame 2005; Gralla 2005). According to this model, expression from an H-NS repressed promoter should require disruption of the nucleoprotein complex and the DNA loop by transcription factors. It has been noted that many of the genes repressed by H-NS require activation signals to overcome repression (Schroder and Wagner 2002; Yu and DiRita 2002).

In a number of promoters, transcription initiation with E⁷⁰ is repressed by H-NS while that with E³⁸ is unaffected. This class includes the hdeAB, csgA, gadB/C, and csiD promoters in E. coli and the spvR promoter in Salmonella typhimurium (Arnqvist et al. 1994; Robbe-Saule et al. 1997; Marschall et al. 1998; Waterman and Small 2003). These promoters contain AT tracts, creating an intrinsic DNA curvature immediately upstream of the promoter. Using the E. coli hdeABp as a model promoter, we investigated the molecular mechanism of selective repression by H-NS to identify differences in transcription initiation by the two forms of RNPs. We suggest that H-NS selectively represses transcription initiation by E⁷⁰ through H-NS-mediated repressive DNA looping, which requires an RP_O with E⁷⁰ acting as a looping factor. We propose here that the selective repression by H-NS is the result of differences in the degree of DNA wrapping around two forms of RNPs.

	Results

Top Abstract Results Discussion Materials and methods Acknowledgments References

 

Regulation of hdeABp by H-NS

We examined the expression profile of hdeABp in E. coli during the course of bacterial growth in LB. The hdeABp activity was determined using a lysogen carrying the hdeABp–lacZYA fusion (Yoshida et al. 1993) to eliminate possible changes in gene copy number. Overnight cultures were diluted 50-fold into fresh LB and grown until the cultures entered stationary phase. Bacterial growth was monitored by measuring the A₆₀₀ (Fig. 1A, open symbols). The lacZ expression level was determined by assaying for -galactosidase activity (Fig. 1A, closed symbols). In the wild-type background (circles), the levels of -galactosidase activity under the control of hdeABp increased as the culture entered stationary phase, reaching a maximum accumulation of 35-fold (Fig. 1A). In the rpoS mutant background (triangles), hdeABp activity was minimal. In the hns and rpoS double-mutant background (squares), however, the hdeABp activity in the exponential phase cultures was elevated at least 35-fold above the wild-type level at stationary phase and gradually increased about twofold in the stationary phase. The further increase in hdeABpinthe hns and rpoS double mutant in the stationary phase was attributed to the hns homolog stpA (Supplementary Fig. 1; Sonden and Uhlin 1996; Zhang et al. 1996). This observation suggested that hdeABp belongs to the class of promoters normally transcribed by E³⁸, but also by E⁷⁰ in the absence of H-NS (Yoshida et al. 1993; Arnqvist et al. 1994; Robbe-Saule et al. 1997; Marschall et al. 1998; Waterman and Small 2003). H-NS selectively represses E⁷⁰-mediated transcription of this class of promoters.

An in vitro transcription assay using purified components with the reconstituted E⁷⁰ or E³⁸ holoenzyme was carried out to examine the selective repression of hdeABp by H-NS. Supercoiled plasmid carrying the hdeABp DNA sequence (-136 to +120 nucleotide [nt]), followed by a strong terminator, was used as the template (Choy and Adhya 1993). Figure 1B shows a gel pattern of multiple round transcription assay. Both E⁷⁰ (Fig. 1B, panel 1) and E³⁸ (Fig. 1B, panel 2) generated the same transcript from hdeABp, as is the case for most other ³⁸ promoters tested in vitro (Kim et al. 2004). In the presence of increasing concentrations of H-NS, the hdeAB transcript generated by E⁷⁰ decreased, while the rna1 transcript from the origin of replication remained constant. The lacUV5p DNA transcribed by E⁷⁰ provided a control. The lacUV5p activity was unaffected by the presence of H-NS (Fig. 1B, panel 3). Thus, the repression of hdeABp by H-NS was promoter specific under these in vitro conditions. Most notably, the hdeAB transcript generated by E³⁸ was not affected by the presence of H-NS. These data suggest that H-NS represses transcription from hdeABp by E⁷⁰, but not by E³⁸, presumably owing to a different mode of interaction between the promoter and the two forms of RNPs, since no other factors are present.

View larger version (27K): [in this window] [in a new window]   Figure 1. Regulatory effect of H-NS. (A) Expression from hdeABp (-136 to +120) fused to lacZYA was determined in vivo in the wild-type background (circles), in the RpoS- mutant background (triangles), and in the RpoS- and Hns- double-mutant background (squares). Lysogens carrying the hdeABp::lacZYA were used for the assay. The expression from hdeABp was determined by -galactosidase assay during bacterial growth into stationary phase. Open symbols represent the bacterial cell mass (A600, right axis) and closed symbols represent -galactosidase activity (A420/min/mL/A600, Miller unit, left axis). (B) Regulatory effect of H-NS as determined by in vitro transcription assay using purified components. DNA templates were supercoiled plasmid DNA that carried hdeABp(-136 to +120, panels 1 and 2)or lacUV5p(-130 to +55, panel 3). Transcription was catalyzed by E70 (panels 1 and 3) or E38 (panel 2). H-NS concentrations in each reaction were 0 (lane 1), 8 nM (lane 2), 25 nM (lane 3), 76 nM (lane 4), and 228 nM (lane 5). The radioactive transcripts were analyzed on an 8 M urea/8% polyacrylamide gel. The major transcripts from the test promoters and rna1 are indicated.

To identify the DNA site at which H-NS acts, a series of hdeABp DNA constructs with truncated 5' ends were constructed and tested. We conducted gel shift assays with this set of hdeABp DNA fragments and purified H-NS protein in the presence of heparin (34 µg/mL) (Fig. 2A). Protein–DNA complexes were separated on a 5% native polyacrylamide gel. A single shifted band of H-NS bound to DNA was detected. The gel shift with the hdeABp DNA fragment deleted to -77 nt showed a reduction in H-NS binding. H-NS was needed at approximately threefold higher concentration to obtain binding comparable to the full-length fragment. Further deletion to -52 nt completely abolished H-NS binding, indicating that H-NS binds primarily upstream of -77 nt. To verify the H-NS-binding site, an in vitro transcription assay was carried out with hdeABp DNA templates truncated at the 5' ends at -136, -77, and -44 nt and the 3' end fixed at +120 nt. Increasing concentrations of H-NS were added while transcription was catalyzed by E⁷⁰ (Fig. 2B). In agreement with the gel shift assay results, we observed no repression by H-NS with DNA truncated at -77 or -44 nt. These results demonstrate that an essential site for H-NS action is between -77 and -136 nt in hdeABp, most likely the AT tract centered at -118 nt (Fig. 2C).

Since it has been shown that H-NS molecules that bind upstream and downstream of the rrnB1 promoter associate to form a repression complex (Dame et al. 2001), we also examined repression with hdeABp DNA truncated at +20 nt (with a fixed 5' end at -136 nt). The in vitro transcription assays with this template showed that the extent of repression was the same irrespective of the 3' end of the template (Fig. 2B, panel 4). It therefore appears that the upstream AT tract is sufficient for the observed repression by H-NS.

Transcription initiation is blocked by H-NS at a step subsequent to RP_O formation

Transcription initiation at hdeABp by E⁷⁰, but not that by E³⁸, is subject to repression by H-NS. The following experiments were conducted to identify which step during transcription initiation by E⁷⁰ is blocked. One model is a simple competition between H-NS and the two forms of RNPs for an overlapping site on hdeABp DNA. This model implies that the binding affinity of E³⁸ > H-NS > E⁷⁰. A gel retardation assay was carried out with H-NS and/or RNP (Fig. 3). H-NS, E⁷⁰, and E³⁸ each bound to the hdeABp DNA (-136 to +120 nt) and migrated at distinct positions on the gel, as shown in Figure 3A. Next, we determined whether H-NS and RNPs could bind simultaneously to hdeABp DNA. Since H-NS, a structural component of the bacterial nucleoid, could induce structural alterations of the DNA that prevent RNP from binding to the promoter (Ussery et al. 1994), the competitive binding assay was carried out by adding RNPs to the preincubating H-NS and hdeABp DNA mix. The addition of E⁷⁰ or E³⁸ to the reaction mix containing hdeABp DNA and H-NS generated new bands that migrated with reduced mobility above the bands of the RNP–DNA binary complex, which indicated the possible formation of hdeABp DNA · RNP · H-NS ternary complexes (Fig. 3A, arrowheads in lanes 4,6). To verify the composition of the supershifted bands, we conducted gel shit assays in which the reaction mixes contained increasing amounts of H-NS alone (Fig. 3B,C, lanes 2–4) or together with 20 nM RNP (Fig. 3B,C, lanes 5–7). These gels were analyzed by Western blotting using antibodies specific for H-NS (Fig. 3B,C, right panels) or the subunit of RNP (Fig. 3B,C, middle panels). The anti- antibody detected the retarded band (Fig. 3B,C, closed arrow) and additional bands underneath that are unbound RNP for both E⁷⁰ and E³⁸ (see Supplementary Fig. 2). Importantly, the anti-H-NS antibody bound not only to the binary DNA–H-NS complexes (Fig. 3B,C, open arrow) but also to the supershifted band (Fig. 3B,C, closed arrow) with both E⁷⁰ and E³⁸. These data suggest that the two forms of RNPs do not compete with H-NS for hdeABp DNA binding, but form a stable RNP–promoter complex, presumably an open promoter complex (see below), in the presence of H-NS.

View larger version (37K): [in this window] [in a new window]   Figure 2. Identification of DNA-binding site on hdeABp at which H-NS exerts its regulatory effect. (A) Gel mobility shift assay with hdeABp DNA constructs with various 5' ends and a fixed 3' end (+120), and H-NS separated on a 5% native polyacrylamide gel. Heparin was added at 34µg/mL prior to loading the reaction mixes onto the gel. The H-NS added in the incubation mix was 0 (lane 1), 76 nM (lane 2), and 228 nM (lanes 3). (B) H-NS titration of in vitro transcription, as described in Figure 1, using hdeABp DNA templates with different 5' ends and a fixed 3'end at +120 (panels 1–3) and hdeABp DNA template carrying the sequence between -136 to +20 (panel 4). H-NS added in the preincubation mix was 0 (lane 1), 25 nM (lane 2), 76 nM (lane 3), and 228 nM (lane 4). (C) The hdeABp sequence. The AT tract centered at -118 nt at which H-NS is thought to bind and -35, -10, and +1 elements are underlined.

It should be emphasized that the DNA distortion induced by E⁷⁰ binding was significantly different from that of E³⁸, especially in the regions outside of the promoter (Fig. 4A,B, cf. lanes 2,3). Figure 4E summarizes those bases that were hyper-reactive to KMnO₄ in the presence of either one of the two forms of RNP. The different patterns of KMnO₄ hypersensitivity generated by two forms of RNPs should reflect differences in the way the DNA wraps around these RNPs (see Discussion).

Mode of repression by H-NS

We investigated the mechanism of repression by H-NS by determining whether a direct protein–protein interaction between H-NS and E⁷⁰ or an indirect effect such as a change in DNA topology, i.e., bending, looping, or supercoiling, was critical for repression. DNA fragments increasing by 5-base-pair (bp) increments (5–20 bp) were inserted at -44.5 nt in the hdeABp DNA (-136 to +30 nt) and these constructs were used to examine the extent of repression of E⁷⁰-mediated transcription by H-NS in vitro (Fig. 5). The addition of the DNA fragments (5–20 bp) only slightly reduced the repressive effect of H-NS in a stepwise manner. No obvious effect of changing the face of the DNA helix by insertion of the fragments was observed. This result indicates that the repression of hdeABp by H-NS is not through a direct interaction with E⁷⁰ (Choy and Adhya 1996; Roy et al. 1998). Therefore, another mechanism, such as a structural change in the DNA induced by H-NS, would better account for the repression by H-NS. We favor a model in which E⁷⁰ is trapped in a DNA loop sealed by oligomeric H-NS spanning the upstream and downstream arms of hdeAB promoter DNA (see below).

View larger version (39K): [in this window] [in a new window]   Figure 3. Simultaneous binding of H-NS and RNP to hdeABp DNA (-136 to +120), as assessed by gel mobility shift (A) and Western analysis (B for E70 binding and C for E38 binding). See text for details. Proteins present in the assays are indicated above each lane. (A) A gel mobility shift assay with 228 nM H-NS and/or 20 nM RNP. For lanes 4 and 6, the DNA was first incubated with H-NS for 10 min and subsequently with RNP for 10 min. (B,C) The hdeABp DNA was incubated in the presence of increasing concentrations of H-NS: 0 (lane 1); 25 nM (lanes 2,5); 76 nM (lanes 3,6); 228 nM (lanes 4,7). For lanes 5–7, 20 nM of RNP was added after incubation of hdeABp DNA and H-NS and the incubation continued an additional 10 min. Panels on the left show gel mobility shift assays on 5% native polyacrylamide gels. The gels were transferred to PVDF membranes and probed with antibody against the subunit of RNP (middle panels) or H-NS (right panels). Bound antibodies were detected by ECL. The closed arrows indicate ternary complexes of DNA · RNP · H-NS and open arrows indicate binary complexes of DNA · H-NS.

Lastly, we employed high-resolution atomic force microscopy (AFM) to visualize the two forms of RNPs bound to hdeABp DNA (-216 to +580) in the presence or absence of H-NS. The DNA–protein complexes were formed using the in vitro reaction conditions and the complexes were deposited on mica and analyzed by AFM. Figure 6 shows hdeABp DNA bound by RNP, in the presence or absence of H-NS. Since E⁷⁰ should interact with the nucleotides approximately between -75 and +25 nt (Darst et al. 1989; Schickor et al. 1990; Craig et al. 1995; Rivetti et al. 1999), on any given promoter, the length of the upstream and downstream DNA arms leaving the RP_O at hdeABp should be asymmetric (141 bp vs. 555 bp). Thus, we considered only those complexes with asymmetric DNA arms with a ratio of 141: 555 (roughly 1:4) projecting out of the RNP molecule to be the genuine RP_O hdeABp. These complexes constituted nearly 49% of the total binary complexes. Figure 6A and B, shows the representative binary complexes formed with E⁷⁰ and E³⁸, respectively. The DNA bound by E⁷⁰ was sharply kinked at the position of the RNP, while DNA bound by E³⁸ was not. To determine the degree of DNA wrapping in the complexes, we measured the DNA contour length of the RNP · hdeABp DNA by tracing the DNA backbone (Rivetti et al. 1999). In agreement with Rivetti et al. (1999), we found the contour length of E⁷⁰ hdeABp DNA was shortened by 80–90 bp (28 nm) when compared with the naked DNA. But, most interestingly, the contour length of E³⁸ hdeABp DNA was reduced only by 18 nm. These data indicate that the nature of the interaction between promoter DNA and the two forms of RNPs is architecturally different.

View larger version (75K): [in this window] [in a new window]   Figure 4. DNA kinks induced by RNP (20 nM, A,B) and/or H-NS binding (228 nM, C,D) to hdeABp DNA (-136 to +120) as probed by KMnO4 assay. Unpaired bases were revealed by primer extension since a supercoiled DNA template was used (see Materials and Methods). A and C show the result of analysis using the primer with the top sequence, and B and D show the result of analysis using the primer with the bottom strand (see Materials and Methods). A and B show the entire sequencing gels, and C and D show those bases around the -10 hexamer. Asterisks indicate unpaired bases at or near the -10 element; open and closed arrowheads indicate those induced by E70 and E38 binding, respectively; and gray arrowheads indicate those induced by both RNPs. The first four lanes in each panel show the DNA sequencing ladder. E shows the top strand bases hyper-reactive to KMnO4 induced by E70 binding (carets above bases) or by E38 binding (carets below bases). The -35, -10, and +1 elements are underlined.

View larger version (24K): [in this window] [in a new window]   Figure 5. Effect of lengthening the interval between H-NS-binding site and hdeABp on H-NS-mediated regulation. DNA fragments increasing by 5-bp increments were inserted at -44.5 nt of the hdeABp DNA (-136 to +30). Inserted DNA fragments were ATCGA (5 bp), CTAGAAACGA (10 bp), CTAGAGCTCGAGCGA (15 bp), and CTAGACCATGGCTCGATCGA (20 bp). (A) Using the hdeABp carrying the above inserts, the repressive effect of H-NS was analyzed by in vitro transcription assay using the procedure described in Figure 1B. H-NS concentrations were 0 (lane 1), 25 nM (lane 2), 76 nM (lane 3), and 228 nM (lane 4). (B) The RNA transcripts were quantified with a scanner (FLA3000), and the fraction (percent) of RNA in each lane relative to RNA made in the absence of H-NS was plotted as a function of H-NS concentration. () hdeABp DNA template carrying no insert; (•) hdeABp DNA template carrying a 5-bp insert; () hdeABp DNA template carrying a 10-bp insert; () hdeABp DNA template carrying a 15-bp insert; and () hdeABp DNA template carrying a 20-bp insert.

	Discussion

Top Abstract Results Discussion Materials and methods Acknowledgments References

 
H-NS has generally been considered a nonspecific silencer of many genes. In this study, we investigated the biochemical mechanism of silencing using hdeABp as a model promoter to differentiate transcription initiation by E⁷⁰ and E³⁸, which share virtually identical promoter specificities (Kim et al. 2004). There is a class of promoters that is regulated in a similar manner to that of hdeAB and that is transcribed by E³⁸, but not by E⁷⁰ in the presence of H-NS (Arnqvist et al. 1994; Robbe-Saule et al. 1997; Marschall et al. 1998; Waterman and Small 2003). Thus, H-NS acts as a repressor of this class of promoters only when E⁷⁰ catalyzes its transcription. In this study, we showed that H-NS repressed transcription from hdeABp by E⁷⁰, but not by E³⁸, in vitro with purified components (Fig. 1) and this activity required the sequence between -77 and -136 nt of hdeABp, most likely involving the AT tract centered at -118 nt, and no other specific sequence (Fig. 2). E⁷⁰ and E³⁸ could each bind to hdeABp DNA in the presence of H-NS (Fig. 3). H-NS repressed hdeABp transcription at a step subsequent to RP_O formation by E⁷⁰, but prior to the formation of the first phosphodiester bond (Fig. 4). The regulatory effect of H-NS was not through direct contact with E⁷⁰ (Fig. 5). AFM showed that E⁷⁰ binding to hdeABp induced a sharp kink in the DNA, but E³⁸ did not (Fig. 6). Most interestingly, the DNA arms projecting out of the E⁷⁰ hdeABp complex were joined in parallel with H-NS in a hairpin-like configuration, but not that of E³⁸ hdeABp. We propose here that H-NS bound to the AT tract centered at -118 nt (nucleation site) laterally extends by cooperatively recruiting H-NS molecules to the downstream sequence joined through DNA wrapping around E⁷⁰, which results in trapping of E⁷⁰ in a DNA loop. Thus, the H-NS-mediated repression would depend on the configuration of DNA wrapping around the RNP.

View larger version (63K): [in this window] [in a new window]   Figure 6. Atomic force microscopy images of representative RNP (20 nM) bound to hdeABp DNA (-216 to +580) in the presence or absence of H-NS (228 nM). A and B show representative montages of E70 and E38 stably bound to hdeABp DNA, respectively. RNP molecules are seen as bright dots. C and D show a montage of representative ternary complexes formed when H-NS bound to hdeABp DNA complexed with E70 (C) or E38 (D). These images show thickening of the DNA arms by H-NS binding, which cross-bridged DNA in the presence of E70 (C). No such DNA bridging was observed with E38 (D). All images show a 300 x 300-nm surface area. Color represents height ranging from 0 to 5 nm from dark to bright. (E) Average contour length of free DNA and RNP-bound DNA. DNA contour length values are the average of at least 20 measurements for each condition. Figures in parentheses are standard deviations. (F) Schematic view of H-NS and two forms of RNPs bound to hdeABp DNA. (Left) E70 binding induces kinks into the target DNA, facilitating oligomerization of the bound H-NS molecules on the DNA arms project out of an E70 · RPO. (Right) H-NS bound to the upstream arm fails to extend to downstream DNA due to the steric distance between the two DNA arms leaving E38 · RPO.

DNA looping has been implicated in transcription repression by repressors that bind to multipartite DNA-binding sites (Choy and Adhya 1996). Association of repressors bound to two separate DNA sites results in looping of the intervening DNA, in which the promoter element is encompassed. The consequence of DNA looping is a perturbation of the DNA helix through torsional inflexibility in short stretches of DNA (Le Bret 1979). Perturbation of the DNA structure within the promoter region then creates a kinetic or energetic barrier for processional movement of the RNP along the DNA. Thus, DNA looping is an energetically costly process. In principle, there should be two classes of DNA looping depending on the nature of the repressor that binds to such multipartite operators. Repressors such as the tetrameric LacI simultaneously bind to a bipartite operator separated by nine helical turns on supercoiled DNA by itself, resulting in the looping out of the intervening DNA (Riggs et al. 1970; Oehler et al. 1990). In contrast, dimeric GalR molecules bound to bipartite operators separated by 11 helical turns associate to form DNA loops on supercoiled DNA only in the presence of HU (Choy et al. 1995; Aki et al. 1996). Therefore, DNA looping should be classified according to the requirement for cofactors that may either bend DNA to facilitate association of DNA-bound repressors or stabilize the looped DNA · protein complex.

RNP has not previously been considered a looping factor, even though the DNA is almost completely wrapped around the open initiation complex. Various experiments have suggested that 30 nm of DNA, corresponding roughly to -75 to +25 nt position of a given promoter, lies in an extensive groove on the surface of E⁷⁰, and wraps 300° around the RNP in the RP_O (Darst et al. 1989; Schickor et al. 1990; Craig et al. 1995; Rivetti et al. 1999). No such DNA wrapping has been observed with the RP_C (Rivetti et al. 1999; Dame et al. 2002). We propose here that DNA looping by H-NS requires an open promoter complex with E⁷⁰ as a cofactor; that is, H-NS forms DNA loops only when the upstream and downstream DNA arms project out of the E⁷⁰. This is because the DNA wrapping in the E⁷⁰ groove puts the DNA arms into such close proximity that oligomeric H-NS extends to the downstream arm of DNA (Fig. 6). Apparently, weak DNA-binding proteins such as H-NS, with a binding constant in the micromolar range (Fried 1989), would never be able to bend short stretches of the DNA helix to create looping by itself, and thus require an aid, the E⁷⁰. AFM images of E⁷⁰ bound to hdeABp DNA in the presence or absence of H-NS convincingly suggested such a mechanism of DNA looping (Fig. 6).

We speculate that DNA wraps around E⁷⁰ through a series of DNA kinks. The unpaired bases on hdeABp DNA created by E⁷⁰ binding detected by KMnO₄ treatment, which should reflect these DNA kinks, appeared at those bases around -70, +50, and +63 nt positions, in addition to those around -10 region (Fig. 4). It is noteworthy that DNA kinks produced by E⁷⁰ at these positions are located far from the boundary of E⁷⁰ on the promoter DNA. These DNA kinks may be induced specifically by RP_O formation with E⁷⁰. We observed that E³⁸ binding induced little DNA kinks, especially downstream of the promoter, suggesting that the promoter DNA wraps around the two forms of RNPs in a different manner. AFM images revealed that the hdeABp DNA bound by E³⁸ was not as sharply kinked or shortened as those bound by E⁷⁰ (Fig. 6). We obtained the same results with lacUV5p DNA bound to the two forms of RNPs: A sharp kink was observed with E⁷⁰ but not with E³⁸ (Supplementary Fig. 3). A similar reduction of 32 nm in the DNA was measured after E⁷⁰ binding but only 19 nm after E³⁸ binding. Thus, we suggest that DNA is more loosely wrapped around E³⁸ than E⁷⁰ (far less than 300°), which would result in the DNA arms leaving the open E³⁸ promoter complex being too far apart for the upstream-bound H-NS to extend to the downstream arm. Thus, such a mechanism would provide an explanation for the observed differential regulatory effect of H-NS on E⁷⁰- and E³⁸-driven transcription initiation, as shown schematically in Figure 6F. A similar mechanism may account for the selective expression of osmYbyE³⁸: Its expression by E⁷⁰ is efficiently repressed by CRP, IHF, and lrp transcription factors (Colland et al. 2000).

We propose here that two forms RNPs may be distinguished not by the promoter specificity, but by a difference in the promoter DNA wrapping around the RNP molecule that could provide a clue for the selective repression by H-NS. It is speculated that this difference may be ascribed to the conformational changes that occur in the core RNP upon binding.

	Materials and methods

Top Abstract Results Discussion Materials and methods Acknowledgments References

 

Strains and plasmids

All E. coli strains used in this study are derived from the MG1655 background. The bacterial strains constructed by P1 transduction and plasmids are listed in Table 1. Bacteriophage carrying hdeABp::lacZYA was obtained from the lysogenic strain TY001, by induction (Yoshida et al. 1993).

Growth conditions

E. coli carrying [hdeABp-lacZYA] were grown in LB medium (Difco Laboratories, Becton Dickinson) containing 1% NaCl with vigorous aeration at 37°C. For solid support medium, 1.5% agar (Difco Laboratories) was included. Antibiotics (Sigma) were added at the following concentrations: ampicillin, 50 µg/mL; tetracycline, 15 µg/mL; kanamycin, 30 µg/mL. X-gal (Sigma) was used at 20µg/mL.

-Galactosidase assay

-Galactosidase assays were performed as described by Miller (1972), using cells permeabilized with Koch's lysis solution (Putnam and Koch 1975). -Galactosidase-specific activity was expressed as Miller units (A₄₂₀/min/A₆₀₀ x 1000). To measure -galactosidase levels in bacteria at different stages of growth, overnight cultures were diluted 1:50 into LB and grown at 37°C until the cultures reached stationary phase. Samples were taken for enzyme assays at regular time intervals. Each strain was assayed in triplicate and average enzyme activities were plotted as a function of time.

In vitro DNA–protein interaction assays

Transcription reactions were carried out using the procedure described by Choy and Adhya (1993). Briefly, 2 nM DNA template, 1 mM ATP, 0.1 mM GTP, 0.1 mM CTP, 0.01 mM UTP, and 10–20 µCi of [-³²P] UTP were preincubated in buffer (20 mM Tris-acetate at pH 7.8, 10 mM magnesium acetate, 100 mM potassium glutamate, 1 mM dithiothreitol) for 5 min at 37°C. H-NS was always included in the preincubation mix. Transcription was initiated by the addition of RNP (20 nM) in a total volume of 20 µL and was terminated after 10 min at 37°Cbythe addition of an equal volume (20 µL) of RNA loading buffer (80% [v/v] deionized formamide, 1x TBE [89 mM Tris, 89 mM boric acid, 2 mM EDTA], 0.025% bromophenol blue, 0.025% xylene cyanole). The mixture was electrophoresed in an 8 M urea/8% polyacrylamide sequencing gel (40 cm x 0.4 mm) for analysis. The RNA transcripts were quantified by determining counts per minute with a scanner (FLA3000, Fuji Instrument).

KMnO₄ reactions followed the protocol described by Rostoks et al. (2000). The reaction conditions were the same as those of in vitro transcription reactions except that nucleotides were omitted. Bases modified by KMnO₄ were analyzed by primer extension analysis using the alkaline denaturation procedure described in Rostoks et al. (2000). The primers were 5'-GGCTTCAACCGAGCTCGTCGACCCGGGTACCGA-3' for the top strand sequence or 5'-GCGGGTTTTTACGTTATTTGC-3' for the bottom strand sequence of the sequences flanking hdeABp.

Gel mobility shift assay

Gel mobility shift assays were carried out as described in Shin et al. (2001). Assays were performed using various PCR fragments of the hdeAB promoter DNA end-labeled with [-³²P]ATP using T4 polynucleotide kinase (Promega). Reaction mixtures contained 2 nM end-labeled hdeABp DNA fragment in transcription buffer and different concentrations of H-NS and/or RNP (see Figs. 2, 3). The mixture was incubated for 10 min at 37°C and then loaded onto a 5% native polyacrylamide gel (50:1) and electrophoresed at 100 V for 1.5 h.

Western blot analysis

A monoclonal antibody against the subunit of RNP was purchased from Neoclone. Anti-H-NS serum was prepared from a New Zealand White rabbit following the procedure described in Lee et al. (2000). DNA–protein complexes on native polyacrylamide gel were transferred to polyvinylidene difluoride (PVDF) membrane and probed with antibody against the subunit of RNP (Neoclone). Bound antibodies were detected by ECL (Amersham) and exposure to X-ray film. The membrane was stripped with Western blotting strip buffer (Pierce) and probed again with anti-H-NS and visualized by ECL.

Atomic force microscopy and analysis

DNA–protein complexes were prepared by incubating RNP (20 nM) and/or H-NS (228 nM) together with 2 nM of the double-stranded 796-bp hdeABp DNA fragment (-216 to +580) obtained by PCR. The mixture was incubated in transcription buffer at 37°C for 10 min, then 10 µL of reaction mix was deposited onto freshly cleaved mica and incubated for 15 min at room temperature. The mica disk was rinsed with distilled water and dried under nitrogen gas. Atomic force microscopic images of DNA–protein complexes under air were obtained with a Nanoscope IIIa (Digital Instruments) in the tapping mode with silicon tips (Digital Instruments). The microscope was equipped with a type J scanner (125 x 125 µm). Images (512 x 512 pixels) were collected with a scan size of 2 µm at a scan rate of 1 scan line/sec.

The DNA contour length of the RNP · promoter DNA complex was measured by tracing the DNA in the AFM images (Rivetti et al. 1999).

Proteins

-Free RNP core enzyme from the BL21 strain was purchased from Epicentre. ⁷⁰ and ³⁸ were purified using the IMPACT system (New England Biolabs). Briefly, the respective factor gene was cloned in frame to the 5' end of intein in the pTYB2 plasmid. Pure was eluted from chitin beads after 1 mM DTT treatment. RNP holoenzymes were prepared by incubating the purified core enzyme and fourfold molar excess of the respective subunit at 37°C for 30 min (Kusano et al. 1996). H-NS was purified from the BL21 strain carrying a plasmid in which hns was cloned under the T7 promoter (pPD3, a gift from E. Bremer, FRG) using the procedure of Dersch et al. (1993).

	Acknowledgments

Top Abstract Results Discussion Materials and methods Acknowledgments References

 
We thank E. Bremer (FRG) for providing plasmids for expression of H-NS. This work was supported by Korea Health 21 R&D (01-PJ10-PG6-01GM02-002) by the Ministry of Health and Welfare, Republic of Korea.

	Footnotes

 
Supplemental material is available at http://www.genesdev.org.

Article and publication are at http://www.genesdev.org/cgi/doi/10.1101/gad.1316305.

⁵ Corresponding author.

E-MAIL hyonchoy{at}chonnam.ac.kr; FAX 82-62-228-7294.

	References

Top Abstract Results Discussion Materials and methods Acknowledgments References

 
Aki, T., Choy, H.E., and Adhya, S. 1996. Histone-like protein HU as a specific transcriptional regulator: Co-factor role in repression of gal transcription by GAL repressor. Genes Cells 1: 179-188.[Abstract]

Arnqvist, A., Olsen, A., and Normark, S. 1994. S-dependent growth-phase induction of the csgBA promoter in Escherichia coli can be achieved in vivo by 70 in the absence of the nucleoid-associated protein H-NS. Mol. Microbiol. 13: 1021-1032.[Medline]

Atlung, T. and Ingmer, H. 1997. H-NS: A modulator of environmentally regulated gene expression. Mol. Microbiol. 24: 7-17.[CrossRef][Medline]

Badaut, C., Williams, R., Arluison, V., Bouffartigues, E., Robert, B., Buc, H., and Rimsky, S. 2002. The degree of oligomerization of the H-NS nucleoid structuring protein is related to specific binding to DNA. J. Biol. Chem. 277: 41657-41666.[Abstract/Free Full Text]

Bordes, P., Repoila, F., Kolb, A., and Gutierrez, C. 2000. Involvement of differential efficiency of transcription by es and e70 RNA polymerase holoenzymes in growth phase regulation of the Escherichia coli osmE promoter. Mol. Microbiol. 35: 845-853.[CrossRef][Medline]

Ceschini, S., Lupidi, G.., Coletta, M., Pon, C.L., Fioretti, E., and Angeletti, M. 2000. Multimeric self-assembly equilibria involving the histone-like protein H-NS. A thermodynamic study. J. Biol. Chem. 275: 729-734.[Abstract/Free Full Text]

Choy, H.E. and Adhya, S. 1993. RNA polymerase idling and clearance in gal promoters: Use of supercoiled minicircle DNA template made in vivo. Proc. Natl. Acad. Sci. 90: 472-476.[Abstract/Free Full Text]

____. 1996. Negative control. In Escherichia coli and Salmonella: Cellular and molecular biology (eds. F.C. Neidhardt et al.), Vol. 1, pp. 1287-1299. ASM Press, Washington, D.C.

Choy, H.E., Park, S.W., Aki, T., Parrack, P., Fujita, N., Ishihama, A., and Adhya, S. 1995. Repression and activation of transcription by Gal and Lac repressors: Involvement of subunit of RNA polymerase. EMBO J. 14: 4523-4529.[Medline]

Colland, F., Barth, M., Hengge-Aronis, R., and Kolb, A. 2000. Factor selectivity of Escherichia coli RNA polymerase: Role for CRP, IHF and lrp transcription factors. EMBO J. 19: 3028-3037.[CrossRef][Medline]

Craig, M.L., Suh, W.C., and Record Jr., M.T. 1995. HO. and DNase I probing of E 70 RNA polymerase– PR promoter open complexes: Mg2+ binding and its structural consequences at the transcription start site. Biochemistry 34: 15624-15632.[CrossRef][Medline]

Dame, R.T. 2005. The role of nucleoid-associated proteins in the organization and compaction of bacterial chromatin. Mol. Microbiol. 56: 858-870.[CrossRef][Medline]

Dame, R.T., Wyman, C., and Goosen, N. 2001. Structural basis for preferential binding of H-NS to curved DNA. Biochimie 83: 231-234.[Medline]

Dame, R.T., Wyman, C., Wurm, R., Wagner, R., and Goosen, N. 2002. Structural basis for H-NS-mediated trapping of RNA polymerase in the open initiation complex at the rrnB P1. J. Biol. Chem. 277: 2146-2150.[Abstract/Free Full Text]

Darst, S.A., Kubalek, E.W., and Kornberg, R.D. 1989. Three-dimensional structure of Escherichia coli RNA polymerase holoenzyme determined by electron crystallography. Nature 340: 730-732.[CrossRef][Medline]

Deighan, P., Beloin, C., and Dorman, C.J. 2003. Three-way interactions among the Sfh, StpA and H-NS nucleoid-structuring proteins of Shigella flexneri 2a strain 2457T. Mol. Microbiol. 48: 1401-1416.[CrossRef][Medline]

Dersch, P., Schmidt, K., and Bremer, E. 1993. Synthesis of the Escherichia coli K-12 nucleoid-associated DNA-binding protein H-NS is subjected to growth-phase control and auto-regulation. Mol. Microbiol. 8: 875-889.[Medline]

Dorman, C.J. 2004. H-NS: A universal regulator for a dynamic genome. Nat. Rev. Microbiol. 2: 391-400.[CrossRef][Medline]

Dorman, C.J., Hinton, J.C., and Free, A. 1999. Domain organization and oligomerization among H-NS-like nucleoid-associated proteins in bacteria. Trends Microbiol. 7: 124-128.[CrossRef][Medline]

Drlica, K. and Rouviere-Yaniv, J. 1987. Histonelike proteins of bacteria. Microbiol. Rev. 51: 301-319.[Free Full Text]

Espinosa-Urgel, M., Chamizo, C., and Tormo, A. 1996. A consensus structure for S-dependent promoters. Mol. Microbiol. 21: 657-659.[CrossRef][Medline]

Falconi, M., Gualtieri, M.T., La Teana, A., Losso, M.A., and Pon, C.L. 1988. Proteins from the prokaryotic nucleoid: Primary and quaternary structure of the 15-kD Escherichia coli DNA binding protein H-NS. Mol. Microbiol. 2: 323-329.[CrossRef][Medline]

Fried, M.G. 1989. Measurement of protein–DNA interaction parameters by electrophoresis mobility shift assay. Electrophoresis 10: 366-376.[CrossRef][Medline]

Friedrich, K., Gualerzi, C.O., Lammi, M., Losso, M.A., and Pon, C.L. 1988. Proteins from the prokaryotic nucleoid. Interaction of nucleic acids with the 15 kDa Escherichia coli histone-like protein H-NS. FEBS Lett. 229: 197-202.[CrossRef][Medline]

Gralla, J.D. 2005. Escherichia coli ribosomal RNA transcription: Regulatory roles for ppGpp, NTPs, architectural proteins and a polymerase-binding protein. Mol. Microbiol. 55: 973-977.[CrossRef][Medline]

Hayatsu, H., Takeishi, K.I., and Ukita, T. 1966. The modification of nucleosides and nucleotides. 3. A selective modification of cytidine with semicarbazide. Biochim. Biophys. Acta 123: 445-457.[Medline]

Hengge-Aronis, R. 1996. Back to log phase: S as a global regulator in the osmotic control of gene expression in Escherichia coli. Mol. Microbiol. 21: 887-893.[CrossRef][Medline]

Hommais, F., Krin, E., Laurent-Winter, C., Soutourina, O., Malpertuy, A., Le Caer, J.P., Danchin, A., and Bertin, P. 2001. Large-scale monitoring of pleiotropic regulation of gene expression by the prokaryotic nucleoid-associated protein, H-NS. Mol. Microbiol. 40: 20-36.[CrossRef][Medline]

Ishihama, A. 2000. Functional modulation of Escherichia coli RNA polymerase. Annu. Rev. Microbiol. 54: 499-518.[CrossRef][Medline]

Kim, E.Y., Shin, M.S., Rhee, J.H., and Choy, H.E. 2004. Factors influencing preferential utilization of RNA polymerase containing -38 in stationary-phase gene expression in Escherichia coli. J. Microbiol. 42: 103-110.[Medline]

Kusano, S., Ding, Q., Fujita, N., and Ishihama, A. 1996. Promoter selectivity of Escherichia coli RNA polymerase E 70 and E 38 holoenzymes. Effect of DNA supercoiling. J. Biol. Chem. 271: 1998-2004.[Abstract/Free Full Text]

Lange, R. and Hengge-Aronis, R. 1991. Identification of a central regulator of stationary-phase gene expression in Escherichia coli. Mol. Microbiol. 5: 49-59.[Medline]

Le Bret, M. 1979. Catastrophic variation of twist and writhing of circular DNAs with constraint? Biopolymers 18: 1709-1725.[CrossRef][Medline]

Lee, S.J. and Gralla, J.D. 2001. 38 (rpoS) RNA polymerase promoter engagement via -10 region nucleotides. J. Biol. Chem. 276: 30064-30071.[Abstract/Free Full Text]

Lee, S.E., Shin, S.H., Kim, S.Y., Kim, Y.R., Shin, D.H., Chung, S.S., Lee, Z.H., Lee, J.Y., Jeong, K.C., Choi, S.H., et al. 2000. Vibrio vulnificus has the transmembrane transcription activator ToxRS stimulating the expression of the hemolysin gene vvhA. J. Bacteriol. 182: 3405-3415.[Abstract/Free Full Text]

Lucht, J.M., Dersch, P., Kempf, B., and Bremer, E. 1994. Interactions of the nucleoid-associated DNA-binding protein H-NS with the regulatory region of the osmotically controlled proU operon of Escherichia coli. J. Biol. Chem. 269: 6578-6586.[Abstract/Free Full Text]

Marschall, C., Labrousse, V., Kreimer, M., Weichart, D., Kolb, A., and Hengge-Aronis, R. 1998. Molecular analysis of the regulation of csiD, a carbon starvation-inducible gene in Escherichia coli that is exclusively dependent on s and requires activation by cAMP-CRP. J. Mol. Biol. 276: 339-353.[CrossRef][Medline]

Miller, J.H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Mulvey, M.R. and Loewen, P.C. 1989. Nucleotide sequence of katF of Escherichia coli suggests KatF protein is a novel