![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RESEARCH PAPER
1 Division of Pediatric Oncology, and 2 Division of Experimental Therapeutics, Sidney Kimmel Comprehensive Cancer Center, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21231, USA; 3 Wilmer Eye Institute, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21287, USA; 4 Calcium Research Laboratory, Department of Medicine, McGill University, Royal Victoria Hospital, Montreal, Quebec, H3A 1A1, Canada; 5 Department of Comparative Medicine, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205, USA
 |
Abstract |
|---|
 Top Abstract ResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
[Keywords: PASG; lsh; SMARCA6; methylation; genomic instability; aging; senescence]
Received December 8, 2003; revised version accepted March 22, 2004.
; Sherr and DePinho 2000), which is believed to be due to physiologic responses to a variety of cellular stresses, including DNA damage and replication (Hayflick 1965; Hasty et al. 2003), telomere erosion (Sharpless and DePinho 2004), and aberrantly activated oncogenes (Lundberg et al. 2000; Campisi 2001). This physiological response appears to trigger growth inhibition via activation of tumor suppressor genes, such as p16INK4a, p19ARF, p53, and p21 (Alcorta et al. 1996; Kiyono et al. 1998; Stein et al. 1999; Ramirez et al. 2001; Randle et al. 2001; Rheinwald et al. 2002; Schmitt et al. 2002; Tyner et al. 2002). Recent data show that bmi-1 is required for the maintenance of tissue homeostasis in some tissues partly because it represses genes that induce cellular senescence and cell death (Jacobs et al. 1999; Itahana et al. 2003; Lessard and Sauvageau 2003; Park et al. 2003, 2004). Furthermore, although the importance of epigenetic modification of DNA and chromatin in normal development and in cancer formation has been established (Li et al. 1992; Okano et al. 1999; Li 2002; Robertson 2002; Eden et al. 2003; Gaudet et al. 2003; Jaenisch and Bird 2003), the relationship to aging or senescence has not been extensively investigated (Issa 1999; Bandyopadhyay and Medrano 2003; Dunn 2003; Richardson 2003).
Decreased 5-methyl-cytosine content of genomic DNA has been observed in aging cells in culture and in animals (Wilson and Jones 1983; Wilson et al. 1987; Barbot et al. 2002). Treatment of cells in culture with DNA methyltransferase (DNMT) inhibitors, such as 5-aza-2'-deoxycytidine, results in a shortened life span compared to untreated control cells (Holliday 1986; Fairweather et al. 1987). DNMT inhibition by antisense oligonucleotides leads to DNA hypomethylation and a senescence-like phenotype, mediated by increased expression of the p16INK4a and p21 tumor suppressor genes in human fibroblasts and cancer cells (Fournel et al. 1999; Young and Smith 2001). Disruption of DNA methyltransferases in primary mouse embryo fibroblasts (MEFs) and human cancer cells is also associated with significantly reduced cell proliferation and aberrant gene expression (Jackson-Grusby et al. 2001; Rhee et al. 2002). These in vitro data suggest that decreasing the level of 5-methyl-cytosine in DNA may be an important molecular mechanism leading to senescence, a concept proposed by Holliday nearly 20 years ago (Holliday 1985). However, in vivo studies investigating premature aging in the context of genomic hypomethylation remain largely unexplored.
Recent studies have linked the ATP-dependent SWI/SNF chromatin remodeling proteins to the regulation of epigenetic modification of the genome, which, in turn, contributes to embryogenesis, cellular proliferation, and oncogenesis through the modulation of transcription, replication, and genome stability (Jeddeloh et al. 1999; Gibbons et al. 2000; Meehan et al. 2001; Li 2002; Robertson 2002; Jaenisch and Bird 2003). PASG (proliferation associated SNF-2-like gene) or lsh (lymphocyte-specific helicase) encodes a SNF-2-like protein that has been shown to contribute to global genome methylation (Lee et al. 2000; Dennis et al. 2001). The term lsh was originally based on findings that suggested it to be expressed as a lymphocyte-specific helicase (Jarvis et al. 1996). Subsequent studies showed that PASG (lsh) is expressed ubiquitously in rapidly dividing cells or tissues (Raabe et al. 2001) and is linked to cell proliferation (Geiman and Muegge 2000; Raabe et al. 2001; Fan et al. 2003). The genetic locus has been termed SMARCA6 (Lee et al. 2000). Lsh-/- mice, in which exons 6 and 7 containing helicase domains I, Ia, and part of II were deleted, displayed perinatal mortality with only one out of 480 mice surviving to 5 d postnatally (Geiman et al. 2001). Newborns were noted to be 22% lower in body weight than wild-type littermates and were noted to have renal tubular abnormalities (Geiman et al. 2001). However, because the null animals died within hours of being born, additional conclusions were not able to be made. To further investigate the functional consequences of PASG (lsh) on epigenetic patterning as well as on normal growth and development, we generated a mouse carrying a hypomorphic mutation of PASG by deleting exons 10, 11, and 12 containing helicase domains III, IV, and part of II using homologous recombination. The results demonstrate that targeted disruption of PASG not only leads to both genomic hypomethylation and re-expression of repressed genes, but also to premature aging that is associated with decreased proliferation and increased replicative senescence along with altered gene expression patterns, particularly the senescence-related genes such as p16INK4a and bmi-1.
|
Results |
|---|
|
TopAbstractResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
Mice with disruption of PASG expression were generated through homologous recombination by deleting exons 10-12, which included the conserved helicase domains II, III, IV (Fig. 1A). Successful targeting of PASG was verified by Southern blot (Fig. 1B), Northern blot hybridization (Fig. 1C), and by Western blot analysis (Fig. 1D). Although a truncated form of mRNA with predicted length (456-bp cDNA was deleted) was observed in the heterozygous (PASG+/-) and homozygous (PASG-/-) mice (Fig. 1C), a short form of PASG protein with deletion of 152 amino acids was not observed by Western blots using a rabbit antibody against the C-terminal sequences of PASG, which was not in the deletion region of the protein (Fig. 1D), suggesting that the truncated protein was possibly not stable or below the level of detection. To further test this possibility by enriching for PASG, we immunoprecipitated PASG with anti-lsh antibody and then did a Western blot of the immunoprecipitated protein with a rabbit antibody against the C-terminal sequences of PASG (Raabe et al. 2001). These results demonstrated that homozygous and heterozygous mice expressed a truncated PASG protein of the predicted size, although its expression level was low (Fig. 1E).
|
|
PASG-/- mice exhibit growth retardation and premature aging
Heterozygous mice are indistinguishable from their wild-type (PASG+/+) littermates and 
20.5% (42 out of 205) of the offspring born from crosses of PASG+/- mice were PASG-/-, which is slightly lower than the expected 25% and possibly due to the cannibalism of dead offspring by the mothers immediately after birth. Approximately 60% of the PASG-/- mice die shortly after or within a few days after birth, with the remaining 40% surviving up to several weeks (Fig. 2F). Although morphologically normal, newborn PASG-/- mice are significantly smaller than their wild-type and heterozygous littermates. A difference in weight is first noted at E12.5 and increases by E15.5 (p 
0.05; Fig. 2G,H). PASG-/- newborn mice have a 25% lower body weight compared to normal littermates, but by 2 wk of age, their body weight is 70% lower than wild-type animals (Fig. 2H). As limiting glucose availability may restrict the ability of growth factors to maintain cellular viability (Vander Heiden et al. 2001), serum glucose levels were serially measured following birth in PASG-/- mice and control littermates. We found that hypoglycemia is observed in postnatal PASG-/- mice (Fig. 2I) with serum glucose concentrations in newborn and postnatal day 15 animals being 52% (p 0.002) and 50% (p 0.0003) less than that of their littermates, despite evidence of adequate nursing and milk present in their stomach. In addition to low birth weight and growth retardation (Figs. 2G,H, 3A), postnatal life is characterized by an early onset of phenotypic changes characteristic of aging, including graying hair and balding, reduced fat deposition, unstable gait, cachexia, and kyphosis (Figs. 3B-D).
|
); such changes have been described as age specific (Hasty et al. 2003).
|
The PASG-/- genotype is associated with replicative senescence in vivo and in vitro and increased karyotypic instability in vitro
To determine if the organs from PASG-/- mice displayed molecular markers of senescence, 
-galactosidase expression in different organs was measured (Dimri et al. 1995). PASG-/- mice strongly express -galactosidase in many of their tissues, as demonstrated in kidneys (Fig. 5A) and thymus (Fig. 5B). No significant expression of -galactosidase is observed in tissues from age-matched, normal littermates. These results show that PASG-/- tissues undergo early onset senescence. Similarly, MEFs derived from PASG-/- embryos show flattened and enlarged morphology, characteristic of a senescence phenotype (Fig. 5C,D), and significantly stronger expression of senescence-associated -galactosidase compared to the wild-type MEFs (Fig. 5C).
|
To better define possible mechanisms leading to the phenotypic changes in mutant animals, we examined the growth characteristics of primary fibroblasts from mutant and wild-type embryos. Early passage MEFs from mutant embryos grow approximately twice as slowly as either PASG+/- or PASG+/+ fibroblasts (Fig. 6A). To quantify the proliferative capacity of PASG deficient MEFs, we calculated population doubling capacity over time. MEFs from PASG-/- embryos show persistent, decreased proliferative capacity after passage 6. However, this decreased proliferative capacity can be rescued by SV40 Large T-antigen transformation (Fig. 6B). Both Large T-antigen transformed wild-type and PASG-/--derived MEFs are able to form tumors in nude mice (four tumors out of eight sites injected with 106 PASG-/- cells and three out of eight using wild-type cells), with the latter MEFs maintaining the same degree of DNA hypomethylation (data not shown). These results demonstrate that PASG-/- MEFs have a significantly decreased proliferation potential, which can be restored possibly by inactivation of p53/Rb pathways. Another characteristic of senescent cells is increased resistance to ionizing radiation. To assess the role of PASG in DNA-damage repair, we exposed MEFs to increasing amounts of ionizing radiation. PASG-/- cells show increased resistance to radiation compared to wild-type MEFs, consistent with a senescent phenotype (Fig. 6C).
|
-irradiation, both PASG-/- and control cells exhibit a radiation-induced delay in S phase and a G2/M arrest followed by recovery from the initial block and re-entry into G1 by 8 h postirradiation (Table 1). These results demonstrate that G1/S and G2/M DNA damage checkpoints are essentially intact in PASG-/--deficient cells, and that PASG-deficient cells complete the cell cycle in a similar fashion to control cells. The results further establish that the reduced proliferation capacity is a result of the lower replicative capacity of PASG-/- MEFs, not due to defects in cell cycle progression. To determine if apoptosis contributes to the reduced proliferative capacity, MEFs were double stained with FITC-annexin V and propidium iodide. No significant increase in apoptotic population is observed in PASG-/- MEFs compared to wild-type cells (data not shown). Therefore, apoptosis is not a major determinant factor in the reduced proliferative capacity of MEFs and growth retardation of mutant mice.
|
), when we measured telomere length using fluorescence in situ hybridization, no significant difference was observed in telomere content from PASG-/--derived bone marrow cells (day 15 after birth) or MEFs (passage 5) compared to controls (data not shown). Examination of in vivo DNA content from tissues sources such as thymus and bone marrow does not reveal aneuploidy. Several possibilities may explain this result. For example, it is possible that a small percentage of cells may develop aneuploidy but be eliminated by in vivo mechanisms, or that the life span of PASG-/- animals is not long enough to allow escape from senescence and expansion of abnormal clones or that additional gene mutations are required, which are more likely to occur under culture conditions.
Increased accumulation of senescence-associated tumor suppressor genes and decreased bmi-1 expression characterize PASG-/- animals and MEFs
Senescence is the final phenotypic state displayed by cells in response to various physiologic types of stress resulting in decreased cell proliferation and often mediated by increased expression and activation of tumor suppressor genes such as p16INK4a, p19ARF, p53, and p21 (Lundberg et al. 2000; Campisi 2001). Prominent among these is p16INK4a (Lundberg et al. 2000). Consistent with this observation, we found the expression of p16INK4a is significantly increased in PASG-/- mice compared to wild-type mice in which its expression is barely detectable (Fig. 6F). The level of p53 and p21 expression was also up-regulated in PASG-/- mice compared to wild-type mice (Fig. 6F), whereas p19ARF was slightly increased in PASG-/- mice despite its low expression level in the wild-type mice (Fig. 6F). To determine whether up-regulation of p16INK4a expression was induced because of promoter CpG demethylation, we sequenced the 5' promoter region of p16INK4a from methylation-specific PCR products of bisulfite modified DNA as described previously. Twenty-five CpG sites were analyzed and shown to be unmethylated in both PASG-/- and wild-type animals (data not shown). The up-regulation of p16INK4a could not thus be attributable to hypomethylation, and alternative mechanisms of p16INK4a expression were therefore examined.
The expression of Ets and Id1, regulators of p16INK4a transcription (Ohtani et al. 2001), was examined by Western blot analysis, which demonstrated no significant expression differences of these gene products between PASG-/- and wild-type mice (data not shown). However, bmi-1, another important negative regulator of p16INK4a, which is also associated with changes in cell proliferation and senescence (Jacobs et al. 1999; Park et al. 2004), is reduced by 50% in tissues from PASG-/- mice compared to control animals (Fig. 6F).
Consistent with these in vivo results, the expression of p16INK4a is also significantly increased in PASG-/- MEFs (Fig. 6G), along with a concomitant decrease in bmi-1. The expression of p19ARF was higher in PASG-/- MEFs compared to wild-type MEFs, whereas the change of p53 and p21 expression level was less pronounced (Fig. 6G), Thus, the disruption of PASG expression and the subsequent replicative senescent phenotype is closely linked to changes of tumor suppressor gene expression. The induction of p16INK4a expression in PASG-/- mice may, in part, be mediated by the reduced expression of the negative inhibitor, bmi-1.
|
Discussion |
|---|
|
TopAbstractResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
). In this study, PASG-/- mice exhibit a phenotype characteristic of early onset of aging. Decreased incorporation of BrdU, accumulation of senescence-associated tumor suppressor genes, and increased senescence-associated -galactosidase as well as the age-related phenotypes in vivo are characteristic of premature aging. However, we cannot rule out that other factors, such as proliferation defects, growth retardation, abnormal lung development, and hypoglycemia, might also contribute to the overall phenotype of PASG-/- animals.
In this study, we demonstrate that targeted disruption of PASG, a SNF2-like factor, leads to genomic hypomethylation and altered gene expression that are linked to developmental growth retardation and premature aging in mice as well as to replicative senescence in PASG-/- MEFs and tissues. These results are the first to link the phenotype of growth retardation and premature aging in mice with epigenetic deregulation due to disruption of a SNF2-like factor, PASG. Although lsh-/- mice were shown to have low birth weight in the previous model, the essentially uniform mortality within hours of being born prevented any detailed postnatal analysis (Geiman et al. 2001). It is unclear why a significant percentage of our PASG-/- mice survive for several weeks of life, but one possibility is that a low level of truncated PASG protein may partially rescue the embryonic null phenotype seen in the previous report (Geiman et al. 2001). The detection of such a truncated mRNA and protein product expressed at a low level supports this conclusion. Furthermore, this targeted deletion of PASG removes the conserved SNF2 helicase domains II, III, and IV, demonstrating that this region of PASG is essential for its normal function. Nevertheless, the extended survival of our PASG-/- animals provides an important opportunity to study in detail the in vivo functions of PASG postnatally. Our PASG-/- model furthermore allows us to demonstrate that the observed growth retardation and premature aging are characterized by a profound up-regulation of tumor suppressor genes such as p16INK4a, p19ARF, p53, and p21 and down-regulation of bmi-1. Among them, p16INK4a up-regulation is most prominent; this increased expression is not due to alterations in promoter methylation, but, instead, is associated with the decreased expression of bmi-1, a negative regulatory of the p16INK4a promoter. Our findings that the premature aging in PASG-/- mice is associated with replicative senescence significantly extend previous work (Wilson and Jones 1983; Holliday 1985; Wilson et al. 1987) and, importantly, links senescence to altered epigenetic patterning and aberrant gene expression.
The maintenance of genomic integrity has emerged as a major factor in cell viability and longevity, with abnormalities leading to telomere shortening or DNA damage and repair being closely linked to senescence, growth retardation, and aging (Hasty et al. 2003; Sharpless and DePinho 2004). Genome instability in patients with Werner syndrome, due to mutations in the WRN DNA helicase, is associated with early onset of aging and cancer predisposition (Hasty et al. 2003). Furthermore, errors in replicating DNA methylation patterns may destabilize genome integrity (Eden et al. 2003; Gaudet et al. 2003) and result in abnormal gene expression, reduced cellular proliferation (Jackson-Grusby et al. 2001), and abnormal embryonic development (Li et al. 1992; Okano et al. 1999). For example, global DNA hypomethylation in DNMT1-deficient ES cells and in mice with a hypomorphic DNMT1 (Dnmt1chip/-) genotype has been shown to contribute to chromosomal instability and an increased incidence of tumor formation (Chen et al. 1998; Eden et al. 2003; Gaudet et al. 2003). Immunodeficiency, chromosome instability, and facial abnormalities characterize the ICF syndrome, a consequence of mutations in the DNMT3b gene (Xu et al. 1999). Similar findings have been observed in animals and MEFs with disruption of Suv39h histone methyltransferases (Peters et al. 2001) and mSds3, an essential component of the functional mSin3/HDAC corepressor complex (David et al. 2003). These important findings demonstrate that normal epigenetic regulation patterns are critical for maintaining genome integrity. Together with the centromeric hypomethylation that we observed in PASG-/- mice and MEFs, these observations strongly suggest that hypomethylation and genome instability may represent fundamental mechanisms capable of leading to premature senescence.
Age-related global hypomethylation has been observed in vitro (Wilson and Jones 1983) and in vivo (Singhal et al. 1987; Wilson et al. 1987; Drinkwater et al. 1989; Barbot et al. 2002). In contrast to the overall reduction in DNA methylation, individual genes may undergo a gradual increase in methylation during the normal process of aging (Issa 1999; Dunn 2003). Genome-wide hypomethylation and site-specific hypermethylation during normal aging can also parallel the findings in cancer cells (Jones and Baylin 2002; Dunn 2003). It has been hypothesized that mechanisms contributing to senescence may protect young organisms from acute death and cancer but predispose them to malignant transformation of somatic cells in later life (Campisi 1996, 2003). This hypothesis has been confirmed in mice lacking Brca1, which is involved in DNA-damage repair and breast cancer (Cao et al. 2003). Aberrant hypomethylation has also been shown to contribute to genome instability and the induction of tumors in the Dnmtchip/- mice (Eden et al. 2003; Gaudet et al. 2003). In this regard, it is important to note that a 75-nt, in-frame deletion of a conserved motif in the C-terminal half of PASG, known to result in dominant negative mutants in similar yeast proteins, has been observed in 40%-60% of acute leukemias in patients, suggesting a potential role for PASG in leukemogenesis (Lee et al. 2000).
Although silencing of p16INK4a expression in tumors is often mediated by promoter hypermethylation (Jones and Baylin 2002), the regulation of p16INK4a expression in senescent cells is poorly understood. Our results showed no differences in p16INK4a promoter region methylation between PASG-/- and wild-type animals as well as mutant or wild-type fibroblasts. Instead, the results demonstrated a 50% reduction in bmi-1 expression in PASG-/- tissues. Bmi-1, a member of the Polycomb/trixthorax group (Pc-G/trx-G) proteins, has been shown to be a negative regulator of p16INK4a expression and is a member of a highly conserved system for regulating epigenetic memory and transcriptional repression during development and cell proliferation (Jacobs et al. 1999; Bird 2002; Lessard and Sauvageau 2003; Orlando 2003; Park et al. 2003, 2004). The mechanisms by which PASG regulates bmi-1 expression remain to be determined.
By leading to deregulation of normal gene expression patterns, altered epigenetic patterning is likely to be an important, underlying, molecular mechanism of senescence. Of further interest, altered regulation of transcriptional repressors, such as bmi-1, may provide an alternative mechanism to changes in DNA methylation in regulating the expression of downstream genes playing essential roles in establishing and/or maintaining a replicative senescence phenotype (Park et al. 2004). Other mechanisms may also independently or cooperatively contribute to the observed senescence phenotype in PASG-/- animals, such as altered chromatin modification, structure and function (Peters et al. 2001; David et al. 2003). Although these observations have important implications for understanding the mechanisms of aging and possibly cancer predisposition, they also raise fundamental questions concerning therapeutic strategies directed toward modifying epigenetic patterns in cancer (Karpf and Jones 2002; Schmitt et al. 2002; Kahlem et al. 2004).
|
Materials and methods |
|---|
|
TopAbstractResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
The PASG targeting vector was constructed using a 3.65-kb EcoRI genomic fragment from 129/SvJ library that was cloned into the 5' arm of pKO Scrambler NTKV-1906 Vector (Stratagene); a 6.5-kb XbalI genomic fragment was cloned into the 3' arm of the vector. With this vector, a 7.126-kb genomic DNA, containing exons 10, 11, and 12 and including helicase domains II, III, and IV, was replaced by the 1.6-kb pGKneo cassette used as a positive selection marker (Fig. 1A).
The targeting vector was electroporated into 129/SvJ ES cells, which were then selected in G418/GCV-containing medium. Targeting frequency was 4/298 (1.3%). Four positive clones were injected separately into C57BL/6J blastocysts to generate chimeric mice. Two clones successfully transmitted the mutant PASG allele to progeny through the germline after the chimeric animals were crossed with normal C57BL/6J mice. Heterozygotic animals were maintained on a mixed 129/SvJ/C57BL/6J background. Similar phenotypes had been observed in 129/SvJ/Swiss black background (data not shown).
Southern and Northern blot analysis
Ten micrograms of DNA were digested with different restriction enzymes and the products electrophoretically resolved in agarose gels, transferred to nylon membranes and hybridized with specific radiolabeled probes. Fifteen micrograms of total RNA, isolated with Trizol (Invitrogen), were electrophoretically separated in formaldehyde agarose gels, transferred to nylon membranes and hybridized with a radiolabeled probe. The IAP probe is homologous to the gag coding region (nt 1570-1899, GenBank accession no. M17551
[GenBank]
; Walsh et al. 1998). The minor satellite centromere probe has been described (Dennis et al. 2001). RNA loading was normalized to GAPDH expression.
DNA methylation and direct DNA sequencing of bisulfite-modified DNA
Direct measurement of methyl-cytosine at CCGG sites was performed as described previously (Li et al. 1992). The p16INK4a promoter (GenBank accession no. U47108
[GenBank]
) was amplified using a 757-bp MSP product containing 25 CpG sites, which was ligated into a TA cloning vector and sequenced as previously described (Frommer et al. 1992). Twenty clones were analyzed from each of two mice. Sense primer was from nt 88 to 112: AGTTGTGTATAGAATTTTAGTATTGA; antisense was from nt 845 to 819: CCATACTACTCCAAATAACTCTCCTC.
Mouse embryo fibroblast assays
Sacrificed embryos from gestation day 13.5 were mechanically dissociated and trypsinized followed by filtration through a 100 µM mesh. MEFs (2 x 104 cells per well) were plated in triplicate into 24-well plates and the cells trypsinized, stained with trypan blue, and counted every 24 h. Proliferation kinetics were measured using the 3T9 assay for MEFs, with 9 x 105 cells being plated in 6-cm tissue culture wells and passaged every third day. Population doubling for each passage was computed using the following formula: log2 (cells harvested/cells seeded). For pulse labeling with BrdU (10 µM, Sigma), 5 x 105 MEFs (passage 3) were plated into 6-cm dishes and BrdU added directly to the media for 2 h after the MEFs had attached (Nussenzweig et al. 1996). For continuous labeling, MEFs (passage 5) were plated with 100 µM BrdU and labeled for 48 h (Frank et al. 1998). Cells were fixed with 70% ethanol and stained with FITC-conjugated anti-BrdU antibodies and propidium iodide according to the manufacturer (BD Pharmagen). A Becton and Dickson FACS machine was used to acquire and analyze a minimum of 10,000 events using the Cellquest program. Radiation sensitivity was measured by treating MEFs with 0, 2, 4, 6, or 8 Gy of -irradiation from a 137Cr source with a dose rate of 0.7 Gy/min. After 5 d in culture, MEFs were collected, stained with trypan blue, and counted. SV40 Large T-antigen transformation was carried out by infection with viral supernatant from the producer cell line 
2-SV40 (Jackson-Grusby et al. 2001). Karyotypes of MEFs were analyzed from colchicine-arrested and Giemsa-stained metaphase chromosome spreads by standard methods.
BrdU labeling of mice
BrdU (100 mg/kg body weight) was injected intraperitoneally into the 14-day-old mice. The mice were killed 2 h after injection; the single cell suspensions from the thymus were stained with anti-BrdU antibody (BD Pharmagen) and analyzed with Becton and Dickson FACS machine.
Histological analysis
Tissues were fixed in 10% neutral buffered formalin, paraffin-embedded, cut into 5-µm sections, and stained with hematoxylin and eosin. Long bones and vertebral bodies were removed and fixed in PLP fixative (2% paraformaldehyde, 0.075 M L-lysine, 0.01 M sodium periodate). The decalcified distal ends of femurs, proximal ends of the tibiae, and vertebral bodies were embedded in LR White acrylic resin (London Resin Company Ltd.) and 1-µm sections cut on an ultramicrotome. These sections were stained for mineral content with the von Kossa staining procedure and counterstained with toluidine blue (Miao et al. 2001). -Galactosidase activity was measured at pH 6.0 as previously described (Dimri et al. 1995). Quantitative fluorescence in situ hybridization was used to determine telomere lengths (Meeker et al. 2002).
Immunoblot analysis and immunoprecipitation
Whole-cell protein was extracted from organs or cultured cells as described previously (Li et al. 1992). Nuclear protein extracts were prepared using the NE-PER Nuclear and Cytoplasmic Extraction Reagents Kit according to the manufacturer's protocol (Pierce). Western blot analysis was performed according to standard procedures using ECL detection (Amersham). PASG protein was detected using a 1:2000 dilution of a rabbit antiserum raised against a peptide sequence in the C-terminal region of PASG that is not in the deletion region (Raabe et al. 2001). The following primary antibodies were used: p16 (M-156, Santa Cruz), p19ARF (NOVUS), bmi-1 (H-99, Santa Cruz), p21 (Ab-6, Oncogene), p53 (Ab-7, Oncogene), Ets1 (C-20, Santa Cruz), Ets2 (C-20, Santa Cruz), and Id1 (C-20, Santa Cruz). Horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibodies (Promega) were used as secondary antibodies.
MEFs cells were collected and lysed in Triton X-100 lysis buffer (150 mM NaCl, 50 mM Tris-HCl, 1% Triton X-100, proteinase inhibitors). PASG protein was immunoprecipitated with anti-lsh antibody (N-16) and detected with a rabbit antiserum raised against a peptide sequence in the C-terminal region of PASG.
|
Acknowledgments |
|---|
|
TopAbstractResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.
|
Footnotes |
|---|
6 Corresponding author.
E-MAIL arcecro{at}jhmi.edu; FAX (410) 502-7223. 
|
References |
|---|
|
TopAbstractResultsDiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
Bandyopadhyay, D. and Medrano, E.E. 2003. The emerging role of epigenetics in cellular and organismal aging. Exp. Gerontol. 38: 1299-1307.[CrossRef][Medline]
Barbot, W., Dupressoir, A., Lazar, V., and Heidmann, T. 2002. Epigenetic regulation of an IAP retrotransposon in the aging mouse: Progressive demethylation and de-silencing of the element by its repetitive induction. Nucleic Acids Res. 30: 2365-2373.
Bird, A. 2002. DNA methylation patterns and epigenetic memory. Genes & Dev. 16: 6-21.
Campisi, J. 1996. Replicative senescence: An old lives' tale? Cell 84: 497-500.[CrossRef][Medline]
____. 2001. Cellular senescence as a tumor-suppressor mechanism. Trends Cell. Biol. 11: S27-S31.[Medline]
____. 2003. Cancer and ageing: Rival demons? Nat. Rev. Cancer 3: 339-349.[CrossRef][Medline]
Cao, L., Li, W., Kim, S., Brodie, S.G., and Deng, C.X. 2003. Senescence, aging, and malignant transformation mediated by p53 in mice lacking the Brca1 full-length isoform. Genes & Dev. 17: 201-213.
Chen, R.Z., Pettersson, U., Beard, C., Jackson-Grusby, L., and Jaenisch, R. 1998. DNA hypomethylation leads to elevated mutation rates. Nature 395: 89-93.[CrossRef][Medline]
David, G., Turner, G.M., Yao, Y., Protopopov, A., and DePinho, R.A. 2003. mSin3-associated protein, mSds3, is essential for pericentric heterochromatin formation and chromosome segregation in mammalian cells. Genes & Dev. 17: 2396-2405.
Dennis, K., Fan, T., Geiman, T., Yan, Q., and Muegge, K. 2001. Lsh, a member of the SNF2 family, is required for genome-wide methylation. Genes & Dev. 15: 2940-2944.
Dimri, G.P., Lee, X., Basile, G., Acosta, M., Scott, G., Roskelley, C., Medrano, E.E., Linskens, M., Rubelj, I., Pereira-Smith, O., et al. 1995. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc. Natl. Acad. Sci. 92: 9363-9367.
Drinkwater, R.D., Blake, T.J., Morley, A.A., and Turner, D.R. 1989. Human lymphocytes aged in vivo have reduced levels of methylation in transcriptionally active and inactive DNA. Mutat. Res. 219: 29-37.[CrossRef][Medline]
Dunn, B.K. 2003. Hypomethylation: One side of a larger picture. Ann. N.Y. Acad. Sci. 983: 28-42.
Eden, A., Gaudet, F., Waghmare, A., and Jaenisch, R. 2003. Chromosomal instability and tumors promoted by DNA hypomethylation. Science 300: 455.
Fairweather, D.S., Fox, M., and Margison, G.P. 1987. The in vitro lifespan of MRC-5 cells is shortened by 5-azacytidine-induced demethylation. Exp. Cell Res. 168: 153-159.[CrossRef][Medline]
Fan, T., Yan, Q., Huang, J., Austin, S., Cho, E., Ferris, D., and Muegge, K. 2003. Lsh-deficient murine embryonal fibroblasts show reduced proliferation with signs of abnormal mitosis. Cancer Res. 63: 4677-4683.
Fournel, M., Sapieha, P., Beaulieu, N., Besterman, J.M., and MacLeod, A.R. 1999. Down-regulation of human DNA-(cytosine-5) methyltransferase induces cell cycle regulators p16(ink4A) and p21(WAF/Cip1) by distinct mechanisms. J. Biol. Chem. 274: 24250-24256.
Frank, K.M., Sekiguchi, J.M., Seidl, K.J., Swat, W., Rathbun, G.A., Cheng, H.L., Davidson, L., Kangaloo, L., and Alt, F.W. 1998. Late embryonic lethality and impaired V(D)J recombination in mice lacking DNA ligase IV. Nature 396: 173-177.[CrossRef][Medline]
Frommer, M., McDonald, L.E., Millar, D.S., Collis, C.M., Watt, F., Grigg, G.W., Molloy, P.L., and Paul, C.L. 1992. A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc. Natl. Acad. Sci. 89: 1827-1831.
Gaudet, F., Hodgson, J.G., Eden, A., Jackson-Grusby, L., Dausman, J., Gray, J.W., Leonhardt, H., and Jaenisch, R. 2003. Induction of tumors in mice by genomic hypomethylation. Science 300: 489-492.
Geiman, T.M. and Muegge, K. 2000. Lsh, an SNF2/helicase family member, is required for proliferation of mature T lymphocytes. Proc. Natl. Acad. Sci. 97: 4772-4777.
Geiman, T.M., Tessarollo, L., Anver, M.R., Kopp, J.B., Ward, J.M., and Muegge, K. 2001. Lsh, a SNF2 family member, is required for normal murine development. Biochim. Biophys. Acta 1526: 211-220.[Medline]
Gibbons, R.J., McDowell, T.L., Raman, S., O'Rourke, D.M., Garrick, D., Ayyub, H., and Higgs, D.R. 2000. Mutations in ATRX, encoding a SWI/SNF-like protein, cause diverse changes in the pattern of DNA methylation. Nat. Genet. 24: 368-371.[CrossRef][Medline]
Hasty, P., Campisi, J., Hoeijmakers, J., van Steeg, H., and Vijg. J., 2003. Aging and genome maintenance: Lessons from the mouse? Science 299: 1355-1359.
Hayflick, L. 1965. The limited in vitro lifetime of human diploid cell stains. Exp. Cell Res. 37: 614-636.[CrossRef][Medline]
Holliday, R. 1985. The significance of DNA methylation in cellular aging. In Molecular Biology of Aging (eds. A.D. Woodhead, A.D. Blackett, and A. Hollaender), pp. 269-283. Plenum Press, New York.
____. 1986. Strong effects of 5-azacytidine on the in vitro lifespan of human diploid fibroblasts. Exp. Cell Res. 166: 543-552.[CrossRef][Medline]
Issa, J.P. 1999. Aging, DNA methylation and cancer. Crit. Rev. Oncol. Hematol. 32: 31-43.[Medline]
Itahana, K., Zou, Y., Itahana, Y., Martinez, J.L., Beausejour, C., Jacobs, J.J., Van Lohuizen, M., Band, V., Campisi, J., and Dimri, G.P. 2003. Control of the replicative life span of human fibroblasts by p16 and the polycomb protein Bmi-1. Mol. Cell. Biol. 23: 389-401.
Jackson-Grusby, L., Beard, C., Possemato, R., Tudor, M., Fambrough, D., Csankovszki, G., Dausman, J., Lee, P., Wilson, C., Lander, E., et al. 2001. Loss of genomic methylation causes p53-dependent apoptosis and epigenetic deregulation. Nat. Genet. 27: 31-39.[CrossRef][Medline]
Jacobs, J.J., Kieboom, K., Marino, S., DePinho, R.A., and van Lohuizen, M. 1999. The oncogene and Polycomb-group gene bmi-1 regulates cell proliferation and senescence through the ink4a locus. Nature 397: 164-168.[CrossRef][Medline]
Jaenisch, R. and Bird, A. 2003. Epigenetic regulation of gene expression: How the genome integrates intrinsic and environmental signals. Nat. Genet. 33 Suppl.: 245-254.
Jarvis, C.D., Geiman, T., Vila-Storm, M.P., Osipovich, O., Akella, U., Candeias, S., Nathan, I., Durum, S.K., and Muegge, K. 1996. A novel putative helicase produced in early murine lymphocytes. Gene 169: 203-207.[CrossRef][Medline]
Jeddeloh, J.A., Stokes, T.L., and Richards, E.J. 1999. Maintenance of genomic methylation requires a SWI2/SNF2-like protein. Nat. Genet. 22: 94-97.[CrossRef][Medline]
Jones, P.A. and Baylin, S.B. 2002. The fundamental role of epigenetic events in cancer. Nat. Rev. Genet. 3: 415-428.[Medline]
Kahlem, P., Dorken, B., and Schmitt, C.A. 2004. Cellular senescence in cancer treatment: Friend or foe? J. Clin. Invest. 113: 169-174.[CrossRef][Medline]
Karpf, A.R. and Jones, D.A. 2002. Reactivating the expression of methylation silenced genes in human cancer. Oncogene 21: 5496-5503.[CrossRef][Medline]
Kiyono, T., Foster, S.A., Koop, J.I., McDougall, J.K., Galloway, D.A., and Klingelhutz, A.J. 1998. Both Rb/p16INK4a inactivation and telomerase activity are required to immortalize human epithelial cells. Nature 396: 84-88.[CrossRef][Medline]
Lee, D.W., Zhang, K., Ning, Z.Q., Raabe, E.H., Tintner, S., Wieland, R., Wilkins, B.J., Kim, J.M., Blough, R.I., and Arceci, R.J. 2000. Proliferation-associated SNF2-like gene (PASG): A SNF2 family member altered in leukemia. Cancer Res. 60: 3612-3622.
Lessard, J. and Sauvageau, G. 2003. Bmi-1 determines the proliferative capacity of normal and leukaemic stem cells. Nature 423: 255-260.[CrossRef][Medline]
Li, E. 2002. Chromatin modification and epigenetic reprogramming in mammalian development. Nat. Rev. Genet. 3: 662-673.[CrossRef][Medline]
Li, E., Bestor, T.H., and Jaenisch, R. 1992. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69: 915-926.[CrossRef][Medline]
Lundberg, A.S., Hahn, W.C., Gupta, P., and Weinberg, R.A. 2000. Genes involved in senescence and immortalization. Curr. Opin. Cell. Biol. 12: 705-709.[CrossRef][Medline]
Meehan, R.R., Pennings, S., and Stancheva, I. 2001. Lashings of DNA methylation, forkfuls of chromatin remodeling. Genes & Dev. 15: 3231-3236.
Meeker, A.K., Gage, W.R., Hicks, J.L., Simon, I., Coffman, J.R., Platz, E.A., March, G.E., and De Marzo, A.M. 2002. Telomere length assessment in human archival tissues: Combined telomere fluorescence in situ hybridization and immunostaining. Am. J. Pathol. 160: 1259-1268.
Miao, D., Bai, X., Panda, D., McKee, M., Karaplis, A., and Goltzman, D. 2001. Osteomalacia in hyp mice is associated with abnormal phex expression and with altered bone matrix protein expression and deposition. Endocrinology 142: 926-939.
