|
|
|
RESEARCH PAPER
1 Medical Research Council Laboratory for Molecular Cell Biology, Cell Biology Unit, and the Biology Department, University College London, London WC1E 6BT, United Kingdom; 2 Centre for Brain Repair, University of Cambridge, Cambridge CB2 2PY, United Kingdom
| Abstract |
|---|
|
|
|---|
[Keywords: Oligodendrocyte precursor cells; neural stem cells; Sox2; Brca1; Brm; histone modification]
Received May 17, 2004; revised version accepted September 21, 2004.
In the present study, we examine changes in the expression of several candidate genes during the conversion of OPCs to 2As and NSLCs. We show that the treatment of OPCs with BMP2 rapidly induces the expression of several genes known to be expressed in at least some neural stem cells (NSCs), including sox2, which encodes a member of the SRY-related, HMG-box-containing, transcription factor family (Gubbay et al. 1990
). Sox2 is one of the earliest known transcription factors expressed in the developing neural tube, and there is increasing evidence that it is essential for the maintenance of NSCs (Zappone et al. 2000
; Bylund et al. 2003
; Graham et al. 2003
). We demonstrate that depletion of Sox2 by RNA interference (RNAi) blocks the proliferation of NSLCs and causes them to differentiate into neurons. We provide evidence that sox2 expression in NSCs and NSLCs depends on both Brca1 and Brm, which is the catalytic subunit in a subset of SWI/SNF chromatin-remodeling complexes. Finally, we show that the conversion of OPCs to NSLCs is associated with the recruitment of Brca1 and Brm to an enhancer in the sox2 promoter and that histone H3 in the enhancer is modified during the conversion to an active form, which is methylated at Lys 4 (K4) and acetylated at Lys 9 (K9). These findings suggest that the conversion is associated with extensive chromatin remodeling, which is mediated in part by Brca1 and Brm.
| Results |
|---|
|
|
|---|
We first addressed whether the BMP-induced conversion of OPCs to 2As is associated with the expression of antigens that are expressed by at least some NSCs. We purified OPCs from postnatal day 6 (P6) rat optic nerve and expanded them for 4 wk in PDGF, in the absence of TH to avoid their differentiation into oligodendrocytes (Barres et al. 1994
). We then recultured the cells for 2 d on PDL-coated slide flasks, either in PDGF alone or in PDGF plus BMP2, and then fixed and immunolabeled them with the A2B5 monoclonal antibody (Eisenbarth et al. 1979
), which labels rat OPCs (Raff et al. 1983
); anti-GFAP antibodies, which label astrocytes (Bignami et al. 1972
) and some NSCs (Doetsch et al. 2002
); and antibodies against Nestin, PSA-NCAM, LeX/SSEA1, or Sox2, all of which are expressed by at least some NSCs (Lendahl et al. 1990
; Seki and Arai 1991
; Li et al. 1998
; Zappone et al. 2000
; Capela and Temple 2002
). Whereas >90% of both OPCs and 2As expressed A2B5 and Nestin, no OPCs expressed GFAP, PSA-NCAM, SSEA1, or Sox2; >90% of the BMP-induced 2As, however, expressed GFAP, 80% expressed SSEA1, 6% expressed PSA-NCAM, and 60% expressed Sox2 (Fig. 1A; data not shown). Thus, BMP2 rapidly induces many OPCs to express antigens that are characteristic of at least some NSCs.
|
We next used RT-PCR to analyze several potentially relevant mRNAs in OPCs, 2As, NSLCs, and NSCs, including sox2, nestin, gfap, brca1, olig2, musashi1, hes1, hes5, bmi1, id1-4, and bcrp1 mRNAs, all of which have been shown to be expressed by at least some NSCs or by more restricted neural precursors. Olig2, hes1, and hes5 encode basic helix-loop-helix (bHLH) transcription factors (Akazawa et al. 1992
; Sasai et al. 1992
; Lu et al. 2000
; Takebayashi et al. 2000
; Zhou et al. 2000
); musashi1 encodes an RNA-binding protein (Nakamura et al. 1994
); bmi1 encodes a polycomb family transcription factor (van Lohuizen et al. 1991
); id1-4 encode HLH proteins that inhibit cell differentiation (Benezra et al. 1990
; Christy et al. 1991
; Sun et al. 1991
; Biggs et al. 1992
; Riechmann et al. 1994
); and bcrp1 encodes an ABC transporter expressed by various types of stem cells (Doyle et al. 1999
).
OPCs were cultured in PDGF alone. We prepared 2As by culturing OPCs in PDGF plus BMP2 for 2 d, and we prepared NSLCs by culturing the 2As in bFGF alone for 1 wk. We prepared NSCs from embryonic day 14.5 (E14.5) mouse telencephalon and expanded them in bFGF for 2 wk (Nakashima et al. 1999
).
As shown in Figure 1B, NSCs expressed all of the examined mRNAs except gfap, whereas OPCs expressed only olig2, musashi1, and nestin mRNAs. (We showed previously that freshly isolated P0 rat OPCs express all four known mammalian Id mRNAs but that id4 rapidly declines as OPCs proliferate in vitro and in vivo [Kondo and Raff 2000b
]; the present results indicate that the other three id mRNAs also eventually decrease as OPCs proliferate in culture and are no longer detectable after 4 wk.) The 2As expressed all but two of the examined mRNAs (hes1 and hes5, both of which encode effectors of Notch signaling), although olig2 mRNA decreased significantly compared to its expression in OPCs. When the 2As were cultured in bFGF for a week (to become NSLCs), they re-expressed both hes1 and hes5 mRNAs but lost gfap mRNA, and olig2 mRNA returned to the level seen in OPCs. Thus, a 2-d exposure to BMP2 induced a global change in gene expression in OPCs, and the patterns of expression in the mRNAs examined were similar in NSCs and NSLCs.
NSLC proliferation and maintenance depends on Sox2
As Sox2 is up-regulated when OPCs are treated with BMP2 (see Fig. 1), we investigated whether the depletion of Sox2 by RNAi would influence the proliferation and/or differentiation of NSLCs. We constructed expression vectors encoding either green fluorescence protein (GFP) alone (control) or GFP and a small interfering RNA specific for sox2 (sox2-siRNA). We first examined whether sox2-siRNA depleted endogenous Sox2. We transfected NSLCs with either the control vector or sox2-siRNA, cultured them in bFGF for 3 d, and then fixed and immunolabeled them for both GFP and Sox2. Compared to the cells transfected with the control vector, the cells transfected with sox2-siRNA showed a greatly reduced expression of endogenous Sox2 (Fig. 2A).
|
To determine whether the knock-down of Sox2 by RNAi causes the spontaneous differentiation of NSLCs, we transfected OPCs, cultured them to produce NSLCs as above, and then fixed and immunolabeled the NSLCs for both GFP and a neural-specific antigeneither Nestin, GFAP, neurofilaments (NFs), which are specifically expressed by neurons (Julien 1999
), or galactocerebroside (GC), which is specifically expressed by oligodendrocytes (Raff et al. 1978
). Whereas over 70% of the cells transfected with the control vector expressed Nestin, only 6% of the cells transfected with sox2-siRNA did so (Fig. 2C), suggesting that Sox2 is required to maintain Nestin expression in NSLCs. Similarly, whereas 10% of the cells transfected with the control vector expressed GFAP, none of the cells transfected with sox2-siRNA did so (Fig. 2D), suggesting that Sox2 helps prolong the expression of GFAP as 2As convert to NSLCs in the presence of bFGF. In contrast, 40% of the cells transfected with sox2-siRNA expressed NFs, whereas none of the cells transfected with the control vector did so (Fig. 2E), suggesting that Sox2 normally inhibits the spontaneous differentiation of NSLCs into neurons. We could not detect any cells expressing GC among the cells transfected with either vector (data not shown), suggesting that Sox2 is not required to prevent the spontaneous differentiation of NSLCs into oligodendrocytes.
Sox2 expression in NSLCs and NSCs depends on Brca1
As Sox2 seems to play an important part in maintaining the proliferation and undifferentiated state of NSLCs, we investigated how sox2 expression is controlled in NSLCs and NSCs. There were two reasons for thinking that Brca1 might be involved in this control, even though it was originally discovered as a tumor suppressor gene that predisposes women to breast and ovarian cancer (Miki et al. 1994
). First, brca1 is expressed in the ventricular zone of the developing rodent brain, as well as in cultured embryonic and adult NSCs (Marquis et al. 1995
; Korhonen et al. 2003
). Second, brca1-/- mice die as embryos, with CNS defects that are very similar to those seen in sox2-/- mice (Hakem et al. 1996
; Liu et al. 1996
; Avilion et al. 2003
). We therefore examined the expression of Brca1 protein in NSCs, OPCs, 2As, and NSLCs. As shown in Figure 3A, Brca1 was not detectably expressed in OPCs but was expressed by 2As, NSLCs, and NSCs, indicating that its expression is up-regulated when OPCs are induced to become 2As and NSLCs.
|
To determine if Brca1 is sufficient to induce sox2 expression in OPCs, we transfected OPCs with an expression vector encoding both mouse Brca1 and GFP, cultured them in bFGF for 7 d, and fixed and immunostained them for GFP and Sox2. None of the GFP-positive cells were labeled for Sox2 (data not shown), suggesting that overexpression of brca1 on its own cannot induce Sox2 expression in OPCs; apparently, other factors are needed.
Both Brca1 and Brm associate with an sox2 enhancer in cultured NSCs
To study the regulation of sox2 expression in our NSCs, we constructed a series of sox2-enhancer-luciferase expression vectors. We inserted the 5'-promoter region of the mouse sox2 gene, or various deleted forms (R1-R3) of the promoter, into the pGL3-promoter vector, which contains a minimal SV40 promoter upstream of a firefly luciferase cDNA (Fig. 4A). We transfected NSCs and 293 cells with these vectors, along with a vector (pEF-Rluc) encoding a sea pansy luciferase. After 24 h, we assayed the firefly luciferase activity, normalized against the sea pansy luciferase activity. As shown in Figure 4A, both the full sox2 promoter and the R1-containing promoter in which R2 and R3 were deleted produced strong luciferase activity in NSCs, but both the R2-containing and R3-containing promoters in which R1 was deleted did not. These findings suggest that R1 contains an enhancer(s) for sox2 expression in cultured NSCs. In contrast, even the full promoter did not produce luciferase activity in 293 cells (Fig. 4A).
|
Although Brca1 is unlikely to bind directly to undamaged DNA, it has been shown to associate with SWI/SNF chromatin-remodeling complexes, which contain several subunits, including Brg1 and Brm (Bochar et al. 2000
). To determine if Brca1 is associated with SWI/SNF complexes in NSCs, we did a ChIP analysis as just described, but using antibodies against Brm or Brg1; we also used antibodies against Brca1 as a positive control and against the Flag epitope as a negative control. As shown in Figure 4C, both the anti-Brca1 and anti-Brm antibodies precipitated the R1 sequence, whereas the anti-Brg1 and anti-Flag antibodies did not, suggesting that Brca1 is associated with Brm-containing SWI/SNF complexes in NSCs.
To confirm that Brca1 and Brm are in the same protein complexes, we prepared extracts of NSCs and treated them with antibodies against Brca1, Brm, or Flag, followed by Protein-A-Sepharose, and then analyzed the immunoprecipitates by Western blotting using anti-Brm antibodies. As shown in Figure 4D, both the anti-Brca1 and anti-Brm antibodies precipitated Brm, whereas the anti-Flag antibody did not, suggesting that at least some Brca1 and Brm are in the same complexes in NSCs. Taken together, these results suggest that both Brca1 and Brm associate with the R1 sox2 enhancer and help activate the transcription of sox2 in NSCs.
Brca1 and Brm are recruited to the R1 when OPCs convert to 2As and NSLCs
To investigate whether Brca1 and Brm are recruited to the R1 when OPCs are induced to convert to 2As and NSLCs, we fixed OPCs, 2As, and NSLCs in formaldehyde and used them for ChIP analysis as described above. As shown in Figure 5A, whereas neither anti-Brca1 nor anti-Brm antibodies precipitated the R1 sequence in OPCs, both of them did so in 2As and NSLCs (Fig. 5A). This suggests that both Brca1 and Brm are recruited to the R1 during the conversion of OPCs to 2As and NSLCs.
|
To examine the relationship between Brm and sox2 expression, we constructed expression vectors encoding either GFP and wild-type human Brm (wBrm) or GFP and a dominant-negative form of human Brm (mutBrm), which has an inactive ATPase domain (Muchardt and Yaniv 1993
; Muchardt et al. 1998
; Bourachot et al. 1999
). We transfected NSLCs with the vectors and immunolabeled the cells after 5 d for GFP and Sox2. Whereas all of the NSLCs transfected with wBrm expressed Sox2 (Fig. 5B), <30% of the NSLCs transfected with mutBrm did so (Fig. 5B), suggesting that Brm and its ATPase-dependent chromatin-remodeling activity promotes the expression of sox2 in NSLCs.
Histone H3 is modified when OPCs convert to 2As and NSLCs
There is increasing evidence that histone modification plays an important part in the control of gene expression during development (Heard et al. 2001
; Litt et al. 2001
; Lunyak et al. 2002
; Song and Ghosh 2004
). The acetylation (Ac) of histone H3 at K9 and its methylation (Me) at K4, for example, is associated with transcriptional activation, whereas the methylation of H3 at K9 is associated with transcriptional silencing. We examined histone H3 modification in the R1 enhancer of sox2 during the conversion of OPCs to NSLCs, using ChIP analysis. As shown in Figure 5C, antibodies specific for methylated K9 in H3 (Me-K9), but not antibodies specific for Me-K4 or Ac-K9, precipitated the R1 sequence from OPC extracts, consistent with the lack of expression of sox2 in these cells; in contrast, antibodies specific for either Me-K4 or Ac-K9 in H3 precipitated the R1 sequence from extracts of both 2As and NSLCs, consistent with the expression of sox2 in both these cell types. Interestingly, antibodies specific for Me-K9 in H3 also precipitated the R1 sequence from extracts of 2As but not from extracts of NSLCs, consistent with the increased expression of sox2 mRNA in NSLCs compared to 2As (see Fig. 1B). These findings suggest that histone H3 is progressively modified as OPCs convert to 2As and then NSLCs.
| Discussion |
|---|
|
|
|---|
We show that OPCs rapidly acquire several molecular characteristics of NSCs when induced by BMPs to become 2As, which provides a plausible explanation for why this induction is apparently a required first step in the conversion of purified OPCs to NSLCs stimulated by extracellular signals (Kondo and Raff 2000a
). Recently, it has been reported that newborn mouse (Belachew et al. 2003
) and adult human (Nunes et al. 2003
) OPCs can behave as NSCs in culture, even without purposeful 2A induction. In these studies, however, the OPCs were exposed to FCS, which contains BMPs (Kondo and Raff 2004
); since even a brief exposure to BMPs is enough to induce 2A development (Mabie et al. 1997
), it is possible that BMP-induced 2A development occurred in these experiments.
We show here that Sox2, which is induced when OPCs convert to 2As and NSLCs, plays an important part in maintaining both the proliferation and undifferentiated state of NSLCs. When Sox2 is knocked down using RNAi, NSLCs stop proliferating, lose the expression of Nestin, and spontaneously differentiate into neurons. This finding is consistent with previous observations in vivo that overexpression of sox2 in mouse NSCs blocks their differentiation and that inhibition of Sox2 in these cells causes their premature exit from the cell cycle and differentiation into neurons (Graham et al. 2003
).
Sox2 expression in both NSCs and NSLCs apparently depends on the tumor suppressor gene brca1, which is induced along with sox2 when OPCs convert to 2As and NSLCs. When Brca1 levels are knocked down in these cells using RNAi, Sox2 protein is substantially decreased. In contrast, when Sox2 levels are knocked down in these cells, Brca1 protein is not detectably decreased, suggesting that Brca1 expression does not depend on Sox2. Although Sox2 expression in NSLCs and NSCs seems to depend on Brca1, overexpression of Brca1 is not enough on its own to induce Sox2 expression in OPCs, suggesting that other factors are also required.
Another protein that seems to be involved in Sox2 expression in NSLCs is Brm, an ATPase subunit in certain SWI/SNF chromatin-remodeling complexes. When a dominant-negative form of Brm, containing an inactive ATPase domain, is expressed in NSLCs, Sox2 protein is substantially decreased, suggesting that the ATPase activity of Brm helps stimulate sox2 expression in these cells. Most importantly, we show using ChIP analysis that both Brca1 and Brm are associated with the R1 enhancer sequence in the sox2 promoter in NSCs, 2As, and NSLCs, but not in OPCs; we show using a luciferase assay that this enhancer sequence is required for sox2-promoter-driven gene expression in NSCs. In coprecipitation assays, we demonstrate that at least some Brca1 and Brm are in the same protein complexes in NSCs.
Taken together, these findings strongly suggest that SWI/SNF remodeling complexes containing Brm and Brca1 are recruited to the R1 enhancer in the sox2 promoter during the conversion of OPCs to 2As and NSLCs, where they help activate sox2 expression. It was shown previously that the expression of sox2 in the developing CNS depends on a patchwork of separate enhancers, each controlling a distinct spatial and temporal pattern of expression (Uchikawa et al. 2003
). The R1 site that we identify here is contained in the enhancer that was previously found to be essential for sox2 expression in telencephalic NSCs in both mouse and chicken (Zappone et al. 2000
; Uchikawa et al. 2003
). Since both Brca1 and Brm are expressed in proliferating NSCs in vivo and in vitro (Marquis et al. 1995
; Korhonen et al. 2003
; this study), it is likely that they both help activate sox2 expression in NSCs in vivo.
Interestingly, Brm-containing SWI/SNF complexes are also recruited to the promoters of both hes1 and hes5 genes in C2C12 myoblasts (Kadam and Emerson 2003
), raising the possibility that these complexes might be required for stem cell maintenance in some nonneural tissues. Moreover, another chromatin-remodeling factor ISWI has been shown to help reprogram a somatic nucleus when it is transplanted into an unfertilized Xenopus egg (Kikyo et al. 2000
), suggesting that chromatin remodeling may be a general feature of reprogramming in which cells (or nuclei) revert to a state with increased developmental potential.
We have also used ChIP analysis to show that H3 histones associated with the R1 sequence in the sox2 promoter undergo progressive modification when OPCs are induced to convert to 2As and then NSLCs. The changes are consistent with the progressive activation of sox2 expression from OPCs-to-2As-to-NSLCs: in OPCs these H3 histones are in an inactive form, with K9 methylated and unacetylated and K4 unmethylated; in 2As they are in a more active form, with K4 methylated and K9 both methylated and acetylated, and in NSLCs they are in an even more active form, with K4 methylated and K9 acetylated but unmethylated. These changes are summarized in the schematic model shown in Figure 6.
|
| Materials and methods |
|---|
|
|
|---|
Animals were obtained from the Animal Facilities at University College London and at University of Cambridge Centre for Brain Repair. Chemicals were purchased from Sigma, except where indicated. Recombinant human PDGF-AA, human BMP2, and human bFGF were purchased from Peprotech.
Cell culture
P6 rat optic nerve OPCs were purified to >98% purity by sequential immunopanning as described previously (Barres et al. 1992
) and cultured in poly-D-lysine (PDL)-coated 100-mm culture dishes (Falcon) in serum-free Dulbecco's Modified Eagle's medium containing bovine insulin (10 µg/mL), human transferrin (100 µg/mL), BSA (100 µg/mL), progesterone (60 ng/mL), putrescine (16 µg/mL), sodium selenite (40 ng/mL), N-acetylcysteine (60 µg/mL), forskolin (5 µM), PDGF (10 ng/mL), penicillin, and streptomycin (GIBCO; culture medium). To induce 2A differentiation, OPCs were cultured in PDL-coated culture dishes or slide flasks (Nunc) in the presence of PDGF and BMP2 (10 ng/mL) for 2-3 d as described before (Kondo and Raff 2004
). To induce the conversion to NSLCs, 2As were cultured in the presence of bFGF (10 ng/mL) for 5-10 d in uncoated dishes. If cultures were maintained for longer than 4 d, half of the medium was replaced every 2 d.
NSCs were prepared from E14.5 mouse telencephalon as described before (Nakashima et al. 1999
) and expanded in bFGF as floating spheres. For immunostaining, the spheres were cultured on poly-L-ornithine (PLO, 15 µg/mL; SIGMA)- and fibronectin (1 µg/mL; Invitrogen)-coated eight-well chamber slides (Nunc) in the presence of bFGF for up to 5 d, as described before (Nakashima et al. 1999
).
RT-PCR analysis
RT-PCR was carried out as described previously (Kondo and Raff 2000b
). Dimethylsulfoxide (DMSO) was added to the reaction mixture: 5% DMSO for olig2, brca1, musashi1, and nestin, and 10% DMSO for sox2 and id1-4. Cycle parameters for sox2, olig2, musashi1, hes1, hes5, bmi1, and nestin were 10 sec at 94°C, 20 sec at 58°C, and 90 sec at 72°C for 35 cycles. For gfap, brca1, id1-4, and bcrp1, they were 10 sec at 94°C, 20 sec at 58°C, and 45 sec at 72°C for 35 cycles. For g3pdh, they were 15 sec at 94°C, 30 sec at 53°C, and 90 sec at 72°C for 23 cycles.
The following oligonucleotide DNA primers were synthesized: For sox2, the 5' primer was 5'-ATGTATAACATGATGGAGACGGAGC-3', and the 3' primer was 5'-TCACATGTGCGACAGGGGCAGTGT-3'. For gfap, the 5' primer was 5'-GAGATGATGGAGCTCAATGACC-3', and the 3' primer was 5'-CTGGATCTCCTCCTCCAGCGA-3'. For olig2, the 5' primer was 5'-ATGGACTCGGACGCCAGCCT-3', and the 3' primer was 5'-TCACTTGGCGTCGGAGGTGAG-3'. For musashi1, the 5' primer was 5'-CCTGGTTACACCTACCAGTTC-3', and the 3' primer was 5'-TCAGTGGTACCCATTGGTGAAG-3'. For brca1, the 5' primer was 5'-ATGGATTTATCTGCTGTTCGAATTC-3', and the 3' primer was 5'-AAACCATTTGCACACTGCATTCC-3'. For bmi1, the 5' primer was 5'-ATG CATCGAACAACCAGAAT-3', and the 3' primer was 5'-TCACTTTCCAGCTCTCCA-3'. For nestin, the 5' primer was 5'-GCTACATACAGGACTCTGCTG-3', and the 3' primer was 5'-AAACTCTAGACTCACTGGATTCT-3'. The primers for hes1, hes5, id1-4, bcrp1, and g3pdh were described previously (Kondo and Raff 2000b
,c
; Kondo et al. 2004
).
Vector construction
To deplete sox2 or brca1 mRNA and to mark the transfected cells, we constructed vectors based on the pMY vector (gift from T. Kitamura, University of Tokyo, Tokyo, Japan) (Misawa et al. 2000
), which encodes green fluorescence protein (gfp) and U6-promoter-driven siRNA for either sox2 (sox2-siRNA) or brca1 (brca1-siRNA). The synthesized sox2-siRNA oligonucleotides were 5'-TCGACAACCAAGACGCTCATGAAGTCAAGAGCTTCATGAGCGTCTTGGTTTTTTA-3' and 5'-AG CTTAAAAAAACCAAGACGCTCATGAAGCTCTTGACTTCATGAGCGTCTTGGTTG-3'. The synthesized brca1 siRNA oligonucleotides were 5'-TCGACAGGGCCTTCACAATGTCCTTTCAAGAGAAGGACATTGTGAAGGCCCTTTTTTT-3' and 5'-CTAGAAAAAAAGGGCCTTCACAATGTCCTTCTCTTGAAAGGACATTGTGAAGGCCCTG-3'.
To construct the series of sox2-enhancer-firefly luciferase expression vectors, mouse sox2 5' genomic DNA (gift from R. Lovell-Badge, NIMR, London, UK) was amplified and cloned into a pGL3-promoter vector (Promega), producing sox2-full-pGL3-pro (full), sox2-R1-pGL3-pro (R1), sox2-R2-pGL3-pro (R2), or sox2-R3-pGL3-pro (R3). The following oligonucleotide DNA primers were synthesized: For R1 (-3833
-3444), the 5' primer was 5'-GTCAAATAGGGCCCTTTTCAG-3', and the 3' primer was 5'-AAGCCAACTGACAATGTTGTGG-3'. For R2 (-3465
-2684), the 5' primer was 5'-CCACAACATTGTCAGTTGGCTT-3', and the 3' primer was 5'-TAGTCTGAACCTCTCCAATG-3'. For R3 (-2704
-1883), the 5' primer was 5'-CATTGGAGAGGTTCAGACTA-3', and the 3' primer was 5'-CTGCCCCAGGTTCTCCTTAAG-3'. Full sox2 5' genomic DNA (-3833
-1883) was amplified with R1 5' primer and R3 3' primer. The transcription start site is considered to be position +1 (Wiebe et al. 2000
).
To determine whether Brm has a role in sox2 expression, we constructed vectors based on the pMY vector, which encodes GFP (to mark transfected cells) and either wild-type human Brm (wBrm) or mutant human Brm (mutBrm), which has an inactive ATPase domain (gift from C. Muchardt, Institut Pasteur, Paris, France).
Transfection
Transfection into OPCs and NSLCs was performed using the Nucleofector procedure according to the supplier's instructions (AMAXA). In brief, 2 x 106 cells were suspended in the Rat NSC Nucleofector Solution (100 µL) with the expression vector (10 µg), and the cells were transfected with the vector using the Nucleofector device. OPCs and NSLCs were then cultured in PDGF or bFGF, respectively.
To examine the effect of the transgenes, the transfected cells were harvested, and 5 x 103 cells per well were recultured in a PLO- and fibronectin-coated eight-well chamber slide (Nunc). To examine the effect on cell differentiation, the cells were cultured for 5 d in bFGF, fixed, and stained for neural markers (see below). To examine the effect on cell proliferation, BrdU (20 µM) was added after 5 d; 8 h later, the cells were fixed and stained for BrdU (see below), and the proportion of GFP+ cells that were BrdU+ was determined.
Immunocytochemistry
Immunostaining was carried out as described previously (Kondo and Raff 2000a
). The following antibodies were used to detect intracellular antigens: monoclonal anti-Nestin (Pharmingen; diluted 1:200), rabbit anti-Sox2 (gift from R. Lovell-Badge; diluted 1:500), rabbit anti-Brca1 (Santa Cruz; diluted 1:200), monoclonal anti-GFAP (Sigma; 1:200), rabbit anti-GFAP (DACO; diluted 1:400), a mixture of rabbit anti-NF antibodies (Affiniti; diluted 1:100), monoclonal anti-GFP, and rabbit anti-GFP (Molecular Probe; diluted 1:200). To detect surface antigens, we used the A2B5 monoclonal antibody to detect OPCs (hybridoma supernatant; diluted 1:5) (Eisenbarth et al. 1979
), monoclonal anti-PSA-NCAM (gift from T. Seki, University of Tokyo, Tokyo, Japan; diluted 1:1000), and monoclonal anti-SSEA1 (Santa Cruz; diluted 1:200). The antibodies were detected with Texas-Red-conjugated goat anti-mouse IgG or IgM (Jackson Immunoresearch; diluted 1:200), fluorescein-conjugated goat anti-rabbit IgG (Jackson Immunoresearch; diluted 1:200), and Alexa-488-coupled goat anti-mouse IgG and Alexa-594-coupled goat anti-rabbit IgG (Molecular Probe; diluted 1:200). Cells were stained for BrdU as previously described (Kondo and Raff 2000b
), by using a monoclonal anti-BrdU antibody (hybridoma culture supernatant; diluted 1:5) (Magaud et al. 1988
), followed by Texas-Red-conjugated goat anti-mouse IgG. To visualize all nuclei, the cells were counterstained with bisbenzimide (Hoechst 33342; 1 µg/mL).
Luciferase assay
NSCs were cultured on PLO- and fibronectin-coated six-well plates (Nunc). On the following day, cells were transfected with 2 µg of the full, R1, R2, or R3 vectors encoding firefly luciferase and 0.2 µg of the internal control vector pEF-Rluc (gift from S. Nagata and K. Shimozaki, Osaka University, Osaka, Japan) encoding sea pansy luciferase using the Superfect Transfection Reagent according to the supplier's instructions (QIAGEN). After 24 h, the activities of the two types of luciferase were measured using the Dual-Luciferase Reporter Assay System according to the supplier's instructions (Promega).
ChIP assay
ChIP assays were performed as described in Shang et al. (2000
). In brief, we fixed 2 x 106 NSCs, OPCs, 2As, or NSLCs in 4% formaldehyde, suspended them in a cell lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl at pH 8.1, 5 mg/mL aprotinin, and 3 mM PMSF), sonicated them, and harvested cell extracts by centrifugation. The extracts were incubated with antibodies overnight and then immunoprecipitated with Protein-A-Sepharose (50 µL of 50% suspension). The following antibodies were used for the assay; anti-Brca1 antibodies (10 µg), anti-Brm antibodies (Santa Cruz; 2 µg), anti-Brg1 antibodies (Santa Cruz; 2 µg), anti-dimethyl-histone H3-K4 antibodies (UPSTATE; 1:100), anti-dimethyl-histone H3-K9 antibodies (UPSTATE; 1:100), and anti-acethyl-histone H3-K9 antibodies (UPSTATE; 1:100). Precipitates were heated to reverse the formaldehyde cross-linking. The DNA fragments in the precipitates were purified by phenol/chloroform extraction and EtOH precipitation and then used for PCR with primer sets for R1, R2, and R3. Cycle parameters were 10 sec at 94°C, 20 sec at 60°C, and 90 sec at 72°C for 30 cycles.
Immunoprecipitation
Immunoprecipitation assays were performed as described in Fukuda et al. (2004
). In brief, 2 x 106 NSCs were harvested, suspended in NP-40 lysis buffer (10 mM Tris-HCl at pH 7.5, 150 mM NaCl, 0.5% NP-40, 5 mM EDTA, 5 mg/mL aprotinin, and 3 mM PMSF), and sonicated. After centrifugation, cell extracts were immunoprecipitated with anti-Flag M2, anti-Brca1, or anti-Brm antibodies and Protein-A-Sepharose. Immunoprecipitates were analyzed using anti-Brm antibodies.
| Acknowledgments |
|---|
|
|
|---|
| Footnotes |
|---|
3 Corresponding author.
E-MAIL tk294{at}cam.ac.uk; FAX 44-1223-334121. ![]()
| References |
|---|
|
|
|---|
Avilion, A.A., Nicolis, S.K., Pevny, L.H., Perez, L., Vivian, N., and Lovell-Badge, R. 2003. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes & Dev. 17: 126-140.
Barres, B.A. and Raff, M.C. 1994. Control of oligodendrocyte number in the developing rat optic nerve. Neuron 12: 935-942.[CrossRef][Medline]
Barres, B., Hart, I., Coles, H., Burne, J., Voyvodic, J., Richardson, W., and Raff, M. 1992. Cell death and control of cell survival in the oligodendrocyte lineage. Cell 70: 31-46.[CrossRef][Medline]
Barres, B., Lazar, M., and Raff, M. 1994. A novel role for thyroid hormone, glucocorticoids and retinoic acid in timing oligodendrocyte development. Development 120: 1097-1108.[Abstract]
Belachew, S., Chittajallu, R., Aguirre, A.A., Yuan, X., Kirby, M., Anderson, S., and Gallo, V. 2003. Postnatal NG2 proteoglycan-expressing progenitor cells are intrinsically multipotent and generate functional neurons. J. Cell Biol. 161: 169-186.
Benezra, R., Davis, R.L., Lockshon, D., Turner, D.L., and Weintraub, H. 1990. The protein Id: A negative regulator of helix-loop-helix DNA binding proteins. Cell 61: 49-59.[CrossRef][Medline]
Biggs, J., Murphy, E.V., and Israel, M.A. 1992. A human Id-like helix-loop-helix protein expressed during early development. Proc. Natl. Acad. Sci. 89: 1512-1516.
Bignami, A., Eng, L.F., Dahl, D., and Uyeda, C.T. 1972. Localization of the glial fibrillary acidic protein in astrocytes by immunofluorescence. Brain Res. 43: 429-435.[CrossRef][Medline]
Bochar, D.A., Wang, L., Beniya, H., Kinev, A., Xue, Y., Lane, W.S., Wang, W., Kashanchi, F., and Shiekhattar, R. 2000. BRCA1 is associated with a human SWI/SNF-related complex: Linking chromatin remodeling to breast cancer. Cell 102: 257-265.[CrossRef][Medline]
Bourachot, B., Yaniv, M., and Muchardt, C. 1999. The activity of mammalian brm/SNF2a is dependent on a high-mobility-group protein I/Y-like DNA binding domain. Mol. Cell. Biol. 19: 3931-3939.
Bylund, M., Andersson, E., Novitch, B.G., and Muhr, J. 2003. Vertebrate neurogenesis is counteracted by Sox1-3 activity. Nat. Neurosci. 6: 1162-1168.[CrossRef][Medline]
Capela, A. and Temple, S. 2002. LeX/ssea-1 is expressed by adult mouse CNS stem cells, identifying them as nonependymal. Neuron 35: 865-875.[CrossRef][Medline]
Christy, B.A., Sanders, L.K., Lau, L.F., Copeland, N.G., Jenkins, N.A., and Nathans, D. 1991. An Id-related helix-loop-helix protein encoded by a growth factor-inducible gene. Proc. Natl. Acad. Sci. 88: 1815-1819.
Dawson, M.R., Polito, A., Levine, J.M., and Reynolds, R. 2003. NG2-expressing glial progenitor cells: An abundant and widespread population of cycling cells in the adult rat CNS. Mol. Cell. Neurosci. 24: 476-488.[CrossRef][Medline]
Doetsch, F., Petreanu, L., Caille, I., Garcia-Verdugo, J.M., and Alvarez-Buylla, A. 2002. EGF converts transit-amplifying neurogenic precursors in the adult brain into multipotent stem cells. Neuron 36: 1021-1034.[CrossRef][Medline]
Doyle, L.A., Yang, W., Abruzzo, L.V., Krogmann, T., Gao, Y., Rishi, A.K., and Ross, D.D. 1999. A multidrug resistance transporter from human MCF-7 breast cancer cells. Proc. Natl. Acad. Sci. 95: 15665-15670.
Eisenbarth, G.S., Walsh, F.S., and Nirenburg, M. 1979. Monoclonal antibodies to a plasma membrane antigen of neurons. Proc. Natl. Acad. Sci. 76: 4913-4916.
Fukuda, S., Kondo, T., Takebayashi, H., and Taga, T. 2004. Negative regulatory effect of an oligodendrocytic bHLH factor OLIG2 on the astrocytic differentiation pathway. Cell Death Differ. 11: 196-202.[CrossRef][Medline]
Graham, V., Khudyakov, J., Ellis, P., and Pevny, L. 2003. SOX2 functions to maintain neural progenitor identity. Neuron 39: 749-765.[CrossRef][Medline]
Gubbay, J., Collignon, J., Koopman, P., Capel, B., Economou, A., Munsterberg, A., Vivian, N., Goodfellow, P., and Lovell-Badge, R. 1990. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 346: 245-250.[CrossRef][Medline]
Hakem, R., de la Pompa, J.L., Sirard, C., Mo, R., Woo, M., Hakem, A., Wakeham, A., Potter, J., Reitmair, A., Billia, F., et al. 1996. The tumor suppressor gene Brca1 is required for embryonic cellular proliferation in the mouse. Cell 85: 1009-1023.[CrossRef][Medline]
Heard, E., Rougeulle, C., Arnaud, D., Avner, P., Allis, C.D., and Spector, D.L. 2001. Methylation of histone H3 at Lys-9 is an early mark on the X chromosome during X inactivation. Cell 107: 727-738.[CrossRef][Medline]
Julien, J.P. 1999. Neurofilament functions in health and disease. Curr. Opin. Neurobiol. 9: 554-560.[CrossRef][Medline]
Kadam, S. and Emerson, B.M. 2003. Transcriptional specificity of human SWI/SNF BRG1 and BRM chromatin remodeling complexes. Mol. Cell 11: 377-389.[CrossRef][Medline]
Kikyo, N., Wade, P.A., Guschin, D., Ge, H., and Wolffe, A.P. 2000. Active remodeling of somatic nuclei in egg cytoplasm by the nucleosomal ATPase ISWI. Science 289: 2360-2362.
Kondo, T. and Raff, M. 2000a. Oligodendrocyte precursor cells reprogrammed to become multipotential CNS stem cells. Science 289: 1754-1757.
____. 2000b. The Id4 HLH protein and the timing of oligodendrocyte differentiation. EMBO J. 19: 1998-2007.[CrossRef][Medline]
____. 2000c. Basic helix-loop-helix proteins and the timing of oligodendrocyte differentiation. Development 127: 2989-2998.[Abstract]
____. 2004. A role for Noggin in the development of oligodendrocyte precursor cells. Dev. Biol. 267: 242-251.[CrossRef][Medline]
Kondo, T., Setoguchi, T., and Taga, T. 2004. Persistence of a small subpopulation of cancer stem-like cells in the C6 glioma cell line. Proc. Natl. Acad. Sci. 101: 781-786.
Korhonen, L., Brannvall, K., Skoglosa, Y., and Lindholm, D. 2003. Tumor suppressor gene BRCA-1 is expressed by embryonic and adult neural stem cells and involved in cell proliferation. J. Neurosci. Res. 71: 769-776.[CrossRef][Medline]
Lendahl, U., Zimmerman, L.B., and McKay, R.D. 1990. CNS stem cells express a new class of intermediate filament protein. Cell 60: 585-595.[CrossRef][Medline]
Li, M., Pevny, L., Lovell-Badge, R., and Smith, A. 1998. Generation of purified neural precursors from embryonic stem cells by lineage selection. Curr. Biol. 8: 971-974.[CrossRef][Medline]
Litt, M.D., Simpson, M., Gaszner, M., Allis, C.D., and Felsenfeld, G. 2001. Correlation between histone lysine methylation and developmental changes at the chicken
-globin locus. Science 293: 2453-2455.
Liu, C.Y., Flesken-Nikitin, A., Li, S., Zeng, Y., and Lee, W.H. 1996. Inactivation of the mouse Brca1 gene leads to failure in the morphogenesis of the egg cylinder in early postimplantation development. Genes & Dev. 10: 1835-1843.
Lu, Q.R., Yuk, D., Alberta, J.A., Zhu, Z., Pawlitzky, I., Chan, J., McMahon, A.P., Stiles, C.D., and Rowitch, D.H. 2000. Sonic hedgehog-regulated oligodendrocyte lineage genes encoding bHLH proteins in the mammalian central nervous system. Neuron 25: 317-329.[CrossRef][Medline]
Lunyak, V.V., Burgess, R., Prefontaine, G.G., Nelson, C., Sze, S.H., Chenoweth, J., Schwartz, P., Pevzner, P.A., Glass, C., Mandel, G., et al. 2002. Corepressor-dependent silencing of chromosomal regions encoding neuronal genes. Science 298: 1747-1752.
Mabie, P.C., Mehler, M.F., Marmur, R., Papavasiliou, A., Song, Q., and Kessler, J.A. 1997. Bone morphogenetic proteins induce astroglial differentiation of oligodendroglial-astroglial progenitor cells. J. Neurosci. 17: 4112-4120.
Magaud, J.P., Sargent, I., and Mason, D.Y. 1988. Detection of human white cell proliferative responses by immunoenzymatic measurement of bromodeoxyuridine uptake. J. Immunol. Methods 106: 95-100.[CrossRef][Medline]
Marquis, S.T., Rajan, J.V., Wynshaw-Boris, A., Xu, J., Yin, G.Y., Abel, K.J., Weber, B.L., and Chodosh, L.A. 1995. The developmental pattern of Brca1 expression implies a role in differentiation of the breast and other tissues. Nat. Genet. 11: 17-26.[CrossRef][Medline]
Miki, Y., Swensen, J., Shattuck-Eidens, D., Futreal, P.A., Harshman, K., Tavtigian, S., Liu, Q., Cochran, C., Bennett, L.M., Ding, W., et al. 1994. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 266: 66-71.
Misawa, K., Nosaka, T., Morita, S., Kaneko, A., Nakahata, T., Asano, S., and Kitamura, T. 2000. A method to identify cDNAs based on localization of green fluorescent protein fusion products. Proc. Natl. Acad. Sci. 97: 3062-3066.
Muchardt, C. and Yaniv, M. 1993. A human homologue of Saccharomyces cerevisiae SNF2/SWI2 and Drosophila brm genes potentiates transcriptional activation by the glucocorticoid receptor. EMBO J. 12: 4279-4290.[Medline]
Muchardt, C., Bourachot, B., Reyes, J.-C., and Yaniv, M. 1998. ras transformation is associated with decreased expression of the brm/SNF2
ATPase from the mammalian SWI-SNF complex. EMBO J. 17: 223-231.[CrossRef][Medline]
Nakamura, M., Okano, H., Blendy, J.A., and Montell, C. 1994. Musashi, a neural RNA-binding protein required for Drosophila adult external sensory organ development. Neuron 13: 67-81.[CrossRef][Medline]
Nakashima, K., Yanagisawa, M., Arakawa, H., Kimura, N., Hisatsune, T., Kawabata, M., Miyazono, K., and Taga, T. 1999. Synergistic signaling in fetal brain by STAT3-Smad1 complex bridged by p300. Science 284: 479-482.
Nunes, M.C., Roy, N.S., Keyoung, H.M., Goodman, R.R., Mc-Khann II, G., Jiang, L., Kang, J., Nedergaard, M., and Goldman, S.A. 2003. Identification and isolation of multipotential neural progenitor cells from the subcortical white matter of the adult human brain. Nat. Med. 9: 439-447.[CrossRef][Medline]
Raff, M.C., Mirsky, R., Fields, K.L., Lisak, R.P., Dorfman, S.H., Silberberg, D.H., Gregson, N.A., Leibowitz, S., and Kennedy, M.C. 1978. Galactocerebroside is a specific cell-surface antigenic marker for oligodendrocytes in culture. Nature 274: 813-816.[Medline]
Raff, M.C., Miller, R.H., and Noble, M. 1983. A glial progenitor cell that develops in vitro into an astrocyte or an oligodendrocyte depending on culture medium. Nature 303: 390-396.[CrossRef][Medline]
Riechmann, V., van Cruchten, I., and Sablitzky, F. 1994. The expression pattern of Id4, a novel dominant negative helix-loop-helix protein, is distinct from Id1, Id2 and Id3. Nucleic Acids Res. 22: 749-755.
Sasai, Y., Kageyama, R., Tagawa, Y., Shigemoto, R., and Nakanishi, S. 1992. Two mammalian helix-loop-helix factors structurally related to Drosophila hairy and Enhancer of split. Genes & Dev. 6: 2620-2634.
Seki, T. and Arai, Y. 1991. The persistent expression of a highly polysialylated NCAM in the dentate gyrus of the adult rat. Neurosci. Res. 12: 503-513.[Medline]
Shang, Y., Hu, X., DiRenzo, J., Lazar, M.A., and Brown, M. 2000. Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103: 843-852.[CrossRef][Medline]
Song, M.R. and Ghosh, A. 2004. FGF2-induced chromatin remodeling regulates CNTF-mediated gene expression and astrocyte differentiation. Nat. Neurosci. 7: 229-235.[CrossRef][Medline]
Sun, X.H., Copeland, N.G., Jenkins, N.A., and Baltimore, D. 1991. Id proteins Id1 and Id2 selectively inhibit DNA binding by one class of helix-loop-helix proteins. Mol. Cell. Biol. 11: 5603-5611.
Takebayashi, H., Yoshida, S., Sugimori, M., Kosako, H., Kominami, R., Nakafuku, M., and Nabeshima, Y. 2000. Dynamic expression of basic helix-loop-helix Olig family members: Implication of Olig2 in neuron and oligodendrocyte differentiation and identification of a new member, Olig3. Mech. Dev. 99: 143-148.[CrossRef][Medline]
Uchikawa, M., Ishida, Y., Takemoto, T., Kamachi, Y., and Kondoh, H. 2003. Functional analysis of chicken Sox2 enhancers highlights an array of diverse regulatory elements that are conserved in mammals. Dev. Cell 4: 509-519.[CrossRef][Medline]
van Lohuizen, M., Verbeek, S., Scheijen, B., Wientjens, E., van der Gulden, H., and Berns, A. 1991. Identification of cooperating oncogenes in E mu-myc transgenic mice by provirus tagging. Cell 65: 737-752.[CrossRef][Medline]
Wiebe, M.S., Wilder, P.J., Kelly, D., and Rizzino, A. 2000. Isolation, characterization, and differential expression of the murine Sox-2 promoter. Gene 246: 383-393.[CrossRef][Medline]
Zappone, M.V., Galli, R., Catena, R., Meani, N., De Biasi, S., Mattei, E., Tiveron, C., Vescovi, A.L., Lovell-Badge, R., Ottolenghi, S., et al. 2000. Sox2 regulatory sequences direct expression of a
-geo transgene to telencephalic neural stem cells and precursors of the mouse embryo, revealing regionalization of gene expression in CNS stem cells. Development 127: 2367-2382.[Abstract]
Zhou, Q., Wang, S., and Anderson, D.J. 2000. Identification of a novel family of oligodendrocyte lineage-specific basic helix-loop-helix transcription factors. Neuron 25: 331-343.[CrossRef][Medline]
![]()
CiteULike
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
H. Fong, K. A. Hohenstein, and P. J. Donovan Regulation of Self-Renewal and Pluripotency by Sox2 in Human Embryonic Stem Cells Stem Cells, August 1, 2008; 26(8): 1931 - 1938. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chen, L. Shi, L. Zhang, R. Li, J. Liang, W. Yu, L. Sun, X. Yang, Y. Wang, Y. Zhang, et al. The Molecular Mechanism Governing the Oncogenic Potential of SOX2 in Breast Cancer J. Biol. Chem., June |