|
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RESEARCH PAPER
21 Wellcome Trust Centre for Cell Biology, University of Edinburgh, EH9 3JR, UK; 2 Department of Microbiology, Montana State University, Bozeman, Montana 59717, USA
| Abstract |
|---|
|
|
|---|
[Keywords: Ribosome export]
Received September 17, 2003; revised version accepted December 2, 2003.
|
/karyopherin-
(Kap-
/Imp-
) family. These proteins consist of repeated, predominantly
-helical, motifs termed HEAT repeats (Huntington-elongation-A subunit-TOR) that are related to Armadillo-like repeats (Andrade et al. 2001
/Imp-
, the HEAT repeats align to form an extended structure with superhelical twist. PR65/A forms an open structure with a regular, left-handed superhelical twist, whereas Imp-
coils up into a tighter, but more irregular and flexible right-handed superhelical structure (Chook and Blobel 1999
Analyses in yeast and vertebrates have shown that a member of the Kap-
/Imp-
family, the export receptor Crm1p/Xpo1p, is required for the export of both the pre-40S and pre-60S ribosomal complexes. Subunit export additionally requires a subset of the nucleoporins, and like all active nuclear transport, also requires the small GTPase Ran (Gsp1p in yeast; Hurt et al. 1999
; Moy and Silver 1999
, 2002
; Ho et al. 2000
; Stage-Zimmermann et al. 2000
; Gadal et al. 2001
; Gleizes et al. 2001
; Thomas and Kutay 2003
; Trotta et al. 2003
). Crm1p binds pre-60S particles via the pre-ribosome-associated protein Nmd3p, which may, in turn, bind to the ribosomal protein Rpl10p (Gadal et al. 2001
). The mode of interaction of Crm1p with pre-40S particles has not yet been determined. Ribosome subunit export clearly requires Crm1p, but it seems unlikely that a single extrinsic protein factor is able to mediate the transit of the much larger subunits through the lumen of NPC.
A proteomic analysis of purified human nucleoli identified 271 proteins (Andersen et al. 2002
), including KIAA0690. A database search identified the yeast homolog as the essential 138-kD protein Ypl012w/Rrp12p. Proteomic analyses identified interactions between Rrp12p and several other proteins involved in ribosome synthesis. These included early binding proteins of the 90S preribosome or U3 processome, and later pre-40S particles (Grandi et al. 2002
; Schafer et al. 2003
), strongly suggesting its participation in late steps of 40S synthesis. However, interactions were also seen with characterized protein components of pre-60S particles (Gavin et al. 2002
), suggesting that it participated in the maturation of both ribosomal subunits. This is an unusual feature, as very few proteins have been shown to participate in the late maturation of both ribosomal subunits, and analyses of pre-ribosomal particles had concluded that the maturation of the two subunits was largely separated (Dragon et al. 2002
; Grandi et al. 2002
). Interestingly, two other very large proteins, Upt10p (200 kD) and Utp20p (287 kD), showed similar behavior and are postulated to associate with the both 90S ribosome or U3 processome and with pre-60 particles (Dragon et al. 2002
; Gavin et al. 2002
; Schafer et al. 2003
).
We report here that Rrp12p, Upt10p, and Utp20p are each predicted to consist of HEAT-repeat motifs, as are five other ribosome synthesis factors including Noc2p, Noc3p, and Noc4p, which are known to be required for subunit export (Milkereit et al. 2001
, 2003
). We propose that these large, extended proteins play key roles in ribosome synthesis by providing a framework for pre-ribosome assembly and participate in subunit export to the cytoplasm.
| Results |
|---|
|
|
|---|
Proteomic analyses suggested that Rrp12p is associated with both the pre-40S and pre-60S ribosomal subunits. To confirm this prediction, Rrp12p was epitope tagged with a tandem-affinity purification (TAP) construct (Rigaut et al. 1999
; see Materials and Methods). Following immunoprecipitation, bound RNA was analyzed by Northern hybridization (Fig. 2A) and primer extension (Figs. 2BD) compared with RNA recovered in parallel from a nontagged control strain (wild-type lanes). Coprecipitation was also performed from a strain expressing Nop15pTAP, which is required for 60S subunit synthesis, but does not participate in 40S subunit synthesis or subunit export (Oeffinger and Tollervey 2003
). The 35S pre-rRNA component of the 90S pre-ribosomes and the 20S pre-rRNA component of the 40S pre-ribosome were coprecipitated with Rrp12p, but not with Nop15p. Primer extension showed that Rrp12pTAP-precipitated 20S pre-rRNA that had undergone dimethylation at residues m26A1779m26A1780 (Fig. 2D). The 20S pre-rRNA is exported to the cytoplasm (see Fig. 1), where this modification is reported to occur prior to the cleavage that generates the mature 18S (Udem and Warner 1973
; Brand et al. 1977
). The mature 18S rRNA was not coprecipitated with Rrp12pTAP, indicating that Rrp12p accompanies the 40S pre-ribosomes to the cytoplasm but dissociates prior to final rRNA maturation. The major pre-60S RNA components, the 27SA2, 27SB, and 7S pre-rRNAs, were coprecipitated with both Rrp12pTAP and Nop15pTAP, whereas the mature 25S and 5.8S rRNAs were precipitated only with Rrp12p. Notably, both the 25S and 5.8S rRNAs are fully matured within the nucleus, unlike the 18S rRNA. No coprecipitation was seen for control RNAs, scR1, or tRNALeu 3.
|
Depletion of Rrp12p inhibits 18S rRNA synthesis and causes accumulation of 3'-5.8S rRNA
To examine the possible functions of Rrp12p in ribosome synthesis, an Rrp12pTAP fusion was expressed under the control of the GAL10 promoter (see Materials and Methods), which is repressed in glucose-based medium. The host strain, YDL401, has reduced galactose permease activity leading to reduced GAL-induction. This eliminates the overexpression generally seen with GAL-regulated constructs, and allows faster appearance of phenotypes following transfer to glucose medium. The GAL::rrp12TAP cells exhibited no detectable growth defect on permissive RGS medium, showing the fusion construct to be functional (data not shown). However, growth declined progressively following transfer to glucose medium commencing around 10 h after transfer (Fig. 3A). Western blotting (Fig. 3B) confirmed the depletion of the fusion protein.
|
|
Pre-rRNA processing was also analyzed by pulse-chase labeling with [H3] uracil following depletion of Rrp12p for 16 h (Fig. 5). Processing of both the 27SA and 27SB pre-rRNAs was retarded, as was the accumulation of the mature 25S and 5.8S rRNAs. Notably, the 25S rRNA signal fell between the 10- and 20-min chase points, possibly due to degradation of rRNA that fails to be exported (see below). Consistent with the Northern data, substantial inhibition of processing of the 20S pre-rRNA to 18S rRNA was seen, with marked accumulation of 20S pre-rRNA and reduced 18S synthesis. Some reduction was also seen in labeling of the 5S rRNA and tRNAs, presumably due to the reduced growth rate.
|
Rrp12p is a nucleolar-cytoplasmic shuttling protein required for export of both 40S and 60S subunits
To determine the steady-state location of Rrp12pTAP, cells were examined by indirect immunofluorescence (Fig. 6A) using a rabbit anti-protein A and a secondary FITC-conjugated goat anti-rabbit antibody to detect the protein A region of the TAP tag (Rigaut et al. 1999
). As a marker for the nucleolus, a DsRed fusion with the nucleolar protein Nop1p was coexpressed (Gadal et al. 2001
), and the nucleoplasm was identified by DAPI staining. Anti-protein A decorated the nucleolus, with a weaker signal over the nucleoplasm.
|
We conclude that Rrp12p is largely localized to the nucleus with nucleolar enrichment at steady state, but is able to shuttle between the nucleus and cytoplasm.
Export of the 40S pre-ribosomes was analyzed by fluorescent in situ hybridization (FISH) as previously described (Moy and Silver 1999
) using a Cy3-labeled probe specific for the 5' region of the pre-rRNA ITS1 (Fig. 6C; Cy3[5'ITS1]). This region is present in the early 35S to 32S pre-rRNAs, and is retained in the 20S pre-rRNA, but absent from mature 18S rRNA (see Fig. 1). In the wild-type and in the GAL::rrp12 strain grown in permissive RGS medium, the pre-rRNA signal is concentrated in the nucleolus (arrows in Fig. 6C) and is also detected in the cytoplasm, where some perinuclear enrichment is visible. The cytoplasmic signal is due to the export of the 20S pre-rRNA prior to final processing to 18S rRNA. No cytoplasmic 20S pre-rRNA is seen in the GAL::rrp12 strain following growth in glucose medium for 16 h, whereas the nucleoplasmic 20S signal is strongly elevated, as shown by its colocalization with the DAPI-stained region.
Export of 60S pre-ribosomes was analyzed in wild-type and GAL::rrp12 strains that expressed a 60S subunit ribosomal protein fused to GFP (Rpl11bGFP) from a CEN plasmid, as previously described (Stage-Zimmermann et al. 2000
). In the wild-type strains and in the GAL::rrp12 grown in permissive RGS medium, Rpl1bGFP was predominately cytoplasmic (Fig. 6D). Depletion of Rrp12p by transfer of the GAL::rrp12strain to glucose medium for 16 h led to a strong reduction in cytoplasmic Rpl11b::GFP signal and its accumulation in the nucleoplasm (Fig. 6D,n).
We conclude that Rrp12p is required for export of both the pre-40S and pre-60S ribosomal subunits from the nucleoplasm to the cytoplasm.
A family of HEAT-repeat proteins associated with pre-ribosomes
In systematic database analyses, Rrp12p was not reported to contain any known protein domains or motifs. However, this seemed unlikely to be the case for a protein of 138 kD, and we therefore undertook independent database searches. Using PSI-BLAST (Altschul et al. 1997
), we found that Rrp12p has similarity to yeast proteins Gcn1p (3rd iteration; E = 1 x 10-16) and Tor1p (3rd iteration; E = 6 x 10-6). More specifically, the region of similarity was in parts of Gcn1p and Tor1p containing arrays of anti-parallel
-helices known as HEAT repeats (Andrade et al. 2001
). According to secondary structure prediction (Jones 1999
), Rrp12p has >60% of its residues in
-helical conformation and only 2% in
-strands, providing further support for its similarity to HEAT repeats. Two independent fold recognition methods, THREADER (Jones et al. 1992
) and 3D-PSSM (Kelley et al. 2000
), also found HEAT-repeat proteins as the most significant matches, indicating that Rrp12p is composed almost entirely of HEAT repeats or closely related modules.
The 3D-PSSM alignment of Rrp12p with the PR65/A subunit of PP2A (Groves et al. 1999
) was improved manually and used to build a three-dimensional (3D) model (Sali and Blundell 1993
). Figure 7A shows ribbon representation of the Rrp12p model (residues 4521018). According to evaluation criteria established for protein homology modeling (Sanchez and Sali 1998
), the model has a probability of 0.98 to contain a correct fold. Figure 7B shows electrostatic surface representation as assigned by GRASP (Nicholls et al. 1991
). Blue color represents regions of positive potential that cluster in larger areas on the inner side of the curved structure. These patches of positive charges are potential candidates for RNA binding.
|
-helical content). Each of these proteins has <4% predicted
-strand content (most have 1%2%) and 60%70%
-helical content. All of these proteins are essential for viability and conserved from yeast to humans, indicating that they play important functions in ribosome synthesis. Noc proteins have already been implicated in ribosomal export (Milkereit et al. 2001
and D. Tollervey, in prep.).
Rrp12p binds to Gsp1p (RAN), FG-repeat nucleoporins and RNA
HEAT-repeat proteins of the Kap-
/Imp-
family interact with the FG-repeat regions of both the GLFG-repeat and FXFG-repeat families of nucleoporins, and with the small GTPase Ran (see Chook and Blobel 2001
; Kuersten et al. 2001
; Kunzler and Hurt 2001
; Weis 2002
, 2003
). These interactions are of key importance for their transport functions. The potential association of Rrp12p with these proteins was assessed by in vitro-binding assays. Ran (Gsp1p in yeast) and the GLFG-repeat regions of Nup100p and Nup116p (Iovine et al. 1995
) and the FXFG-repeat region of Nsp1p were each expressed as GST fusions and purified from Escherichia coli. As controls, we also purified GST itself and GST fusions with three other proteins Prp20p (RCC1), Rrp41p, and Rrp44p (Dis3p). Rrp12p was apparently toxic when expressed in E. coli, and was therefore synthesized by in vitro transcription and translation in the presence of [35S]methionine. The GST-fusion proteins were bound to glutathione Sepharose and then incubated with [35S]-labeled Rrp12p. Following extensive washing, bound proteins were eluted and analyzed by autoradiography to assess the association with Rrp12p.
The association of Rrp12p with Gsp1p was assessed for the GTP and GDP-bound forms (Fig. 8A, lanes 2,3). Immediately prior to incubation with Rrp12p, the nucleotide bound to Gsp1p was exchanged for either GDP or GTP, as previously described (Weis et al. 1996
). A high efficiency of exchange was confirmed using radiolabeled nucleotides (data not shown). Strong binding was seen between Rrp12p and both Gsp1pGTP and Gsp1pGDP. To confirm that apparent binding of Rrp12p to RanGTP was not a consequence of hydrolysis of GTP to GDP during the course of the incubation, the binding assay was also performed using the nonhydrolyzable GTP analog GDPNP. Rrp12p associated with Gsp1pGDPNP with efficiency similar to Gsp1pGTP and GDP (Fig. 8A). In the input (Fig. 8A, lane 1) and unbound material that was recovered in the supernatant following the incubation (Fig. 8A, lanes 36), truncated species are visible, which are likely to arise from premature translation termination in vitro. Notably, these were much less efficiently recovered in the bound fraction than was the full-length Rrp12p, confirming the specificity of the interaction.
|
To further assess binding of Gsp1p and the nucleoporins, Rrp12pTAP was recovered from a yeast cell lysate by precipitation on IgG-Sepharose beads, followed by washing with 1.6 M MgCl2. The protein A-IgG interact ion is resistant to this stringent wash, but proteins bound to the column indirectly via Rrp12p are expected to be removed (Görlich et al. 1996
). Mass-spectroscopic analysis of proteins eluted by SDS treatment following the MgCl2 wash identified only Rrp12pTAP and the IgG heavy and light chains, whereas only Rrp12p and TEV were observed following elution by TEV cleavage (data not shown). We cannot, however, exclude the possibility that additional proteins were present in substoichiometric amounts, despite the stringent wash conditions. The Rrp12pTAP column was incubated with GST and the GST-fusion proteins. Following washing and elution, these were identified by Western blotting with anti-GST (Fig. 8B). GSTGsp1pGTP, GSTGsp1pGDP, GSTGsp1GDPNP, GSTNup100p, and GSTNup116p were each bound and was recovered from the Rrp12pTAP column. However, no binding was seen for the FXFG repeat region of Nsp1p, in contrast to the reverse-binding interaction shown in Figure 8B. The reason for this is unclear.
The ability of Rrp12p to associate with RNA was assessed by in vitro binding to the homopolymeric ribonucleotides, poly(A) and poly(U) sepharose (Fig. 9A). Clear binding of [35S]-labeled Rrp12p was seen to poly(A) Sepharose and almost all of the Rrp12p present bound to poly(U) Sepharose, resulting in its substantial depletion from the unbound sample. In contrast, no binding of Rrp12p was detected for the control glutathione Sepharose and protein A Sepharose samples. In vitro binding was further assessed using tRNASup3e (kindly provided by E. Betrand, University of Montpellier) and a transcript corresponding to the pre-rRNA region extending from ITS1 to ITS2 and including processing sites A2, A3, B1, E, and C2 (see Fig. 1A). Transcripts were synthesized in vitro, incorporating biotinylated-UTP immobilized on streptavidin-agarose beads and incubated with [35S]-labeled Rrp12p (Fig. 9B). Comparison of the bound and unbound fractions (twofold more of the bound fraction was loaded) showed substantial binding of Rrp12p (
50% of the input) to the pre-rRNA transcript and its corresponding depletion from the unbound fraction. In contrast, binding of Rrp12p to the tRNA transcript was not clearly above the background level with streptavidin agarose alone.
|
| Discussion |
|---|
|
|
|---|
Around 140 proteins have been identified that function in the post-transcriptional steps in ribosome synthesis, but few have been shown to participate in the formation of both the 40S and 60S subunits and only one, Rrp5p, has been shown to function directly in formation of both the 18S and the 25S/5.8S rRNAs (Venema and Tollervey 1996
; Torchet et al. 1998
; Eppens et al. 1999
). Here, we report that Rrp12p is required for the late maturation of the 18S and 5.8S rRNA. Rrp12p is a component of the 90S pre-ribosomes, and remains associated with the 20S pre-rRNA component of the pre-40S ribosomes until its methylation, which probably occurs in the cytoplasm. Rrp12p is also present in the pre-60S ribosomes throughout the maturation of the 25S and 5.8S rRNAs. These data are consistent with the association of Rrp12p with the exported forms of both the pre-40S ribosomes, which contains the 20S pre-rRNA, and pre-60S ribosomes, which contains the mature 25S and 5.8S rRNAs. The 3'-extended pre-5.8S rRNA species seen in strains lacking Rrp12p are the same as those described for mutations in Gsp1p (Ran; Suzuki et al. 2001
), suggesting that efficient maturation may be linked to the acquisition of export competence. Recent analyses in Xenopus oocytes also indicate a link between 5.8S rRNA 3' maturation and 60S subunit export (E. Lund, pers. comm.), so this may be a conserved feature.
Recent models have proposed that gating during nuclear import and export largely depends on the hydrophobic FG repeat regions of the nucleoporins preventing free diffusion (Ribbeck and Gorlich 2002
; Gorlich et al. 2003
). Hydrophilic RNA and proteins that are unable to interact with the FG repeats are effectively excluded from the lumen of the NPC. Export of both 40S and 60S subunits requires Ran and Crm1p (Xpo1p) in yeast (Ho et al. 2000
; Gadal et al. 2001
; Moy and Silver 2002
) and vertebrates (Thomas and Kutay 2003
; Trotta et al. 2003
). Crm1p interacts with the 60S subunit via the adaptor protein Nmd3p, which in turn binds to Rpl10p. However, it is unclear how a single export factor, bound indirectly to the much larger pre-60S subunit, could mediate its passage through the lumen of NPC. Transport might be initiated by interaction of Crm1p with the NPC, but we propose that the surfaces of both pre-ribosomal subunits carry Rrp12p, and perhaps other extended HEAT-repeat proteins, which can interact directly with the FG repeats of the nucleoporins and with RanGTP. These are envisaged to help cover the hydrophobic RNA surfaces of the ribosomal subunits, allowing them to dissolve into the hydrophobic mesh of the nucleoporin FG repeats.
Of the other seven HEAT-repeat proteins we identified, Sda1p, Noc1p, Noc2p, and Noc3p are each required for pre-rRNA processing on the pathway of 60S subunit synthesis (Milkereit et al. 2001
; Ihmels et al. 2002
), whereas Noc4p participates in 40S synthesis (Milkereit et al. 2003
). Previous analyses indicated that a Noc1/2p complex associates with an early, nucleolar pre-60S particle, whereas a Noc2/3p complex associates with a later nucleoplasmic particle (Milkereit et al. 2001
). Mutation of Noc1p leads to nucleolar accumulation of a 60S export reporter Rpl25peGFP. In contrast, mutation of Noc3p leads to nucleoplasmic accumulation, whereas mutation of Noc2p gave stronger accumulation in the nucleolus than nucleoplasm (Milkereit et al. 2001
). Mutation of Noc4p leads to the nuclear accumulation of a 40S export reporter Rps2pGFP, consistent with a role in pre-40S subunit export, but did not affect pre-60S export (Milkereit et al. 2003
). Subunit export defects have not yet been assessed for Sda1p, Utp10p, or Utp20p.
Previous proteomic analyses clearly implicated Rrp12p, Utp10p, and Utp20p in 40S synthesis, but the evidence for association with pre-60S rested on their co-purification with other known 60S synthesis factors and Bud20pTAP. The association of Rrp12p with late pre-60S particles is established by the data reported here, and we speculate that this will also be the case for Utp10p and Utp20p. It is notable that many other pre-60S synthesis factors also failed to be detected in previous proteomic analyses. These include all of the known processing enzymes; the endonucleases Rnt1p and the RNase MRP complex, the 5'
3' exonucleases Rat1p and Xrn1p, and the 3'
5' exonucleases of the exosome complex as well as Rex1p, Rex3, and Ngl2p. Also absent are several RNA helicases known to be required for ribosome synthesis and almost all of the snoRNAs that have been tested, with the exception of U3. It follows that many of the most important components associated with the pre-ribosomes in vivo dissociate during cell harvesting and/or the purification procedures. In the case of export factors, an obvious possibility is that breakdown of the nuclear envelope during cell lysis disrupts the RanGTP/GDP gradient, leading to their rapid dissociation from export-competent pre-ribosomes.
Gsp1pGTP and Gsp1pGDP bound to recombinant Rrp12p in vitro with similar efficiency, as did Ran loaded with the nonhydrolyzable analog GDPNP. Yeast Kap-
/Imp-
binds in vitro to both Gsp1pGTP and Gsp1pGDP, but binding to the GDP form is much weaker (Floer and Blobel 1996
), and the exosome component hDis3p is reported to bind to either GTP or GDPRan (Shiomi et al. 1998
). In vivo, Rrp12p may bind to RanGTP as components of the export-competent pre-ribosomes, and bind RanGDP, while recycling into the nucleus. It is, however, also possible that the in vivo Ran-binding properties of Rrp12p are rather different from those of the recombinant protein in vitro. The structure of Kap-
/Imp-
changes substantially on binding to other proteins (Chook and Blobel 1999
; Cingolani et al. 1999
; Groves et al. 1999
; Vetter et al. 1999
; Bayliss et al. 2000
; Lee et al. 2000
), and the structure of Rrp12p may well be altered on binding to the pre-ribosomes. Binding of Crm1p/Xpo1p to Gsp1pGTP is stable only in the presence of Yrb1p (yeast RanBP1; Maurer et al. 2001
). Kap-
/Imp-
makes extensive contacts with RanGTP that extend over several HEAT repeats (Vetter et al. 1999
). An acidic loop region accounts for part of this interaction, but a similar acidic region is not apparent in the sequence of Rrp12p.
Another, apparently major, problem in eukaryotic ribosome synthesis arises from the use of modification guide snoRNAs to direct the covalent modification of the rRNA sequences. This requires that the core of the rRNA initially remains unfolded and accessible to the many snoRNAs with which it must base pair. Subsequent formation of the mature ribosomal subunits will clearly require large-scale refolding of the rRNA and reorganization of the pre-ribosomal particles. We speculate that the extended HEAT-repeat proteins form a scaffold for pre-ribosome assembly and pre-rRNA unfolding/refolding. A function as a scaffold has been proposed for PR65/A, which assembles the catalytic subunit together with a range of different regulatory B subunits to form the PP2A complex (Groves et al. 1999
).
| Materials and methods |
|---|
|
|
|---|
Growth and handling of S. cerevisiae were by standard techniques. GAL-regulated strains were pregrown in RGS medium containing 2% raffinose, 2% galactose, and 2% sucrose, and harvested at intervals following a shift to medium containing 2% glucose. Strains for pulse-chase analysis were pregrown in minimal RGS medium lacking uracil and shifted to minimal glucose medium lacking uracil. Strains for immunofluorescence studies were grown in minimal glucose medium lacking tryptophan. Yeast strains used and constructed in this study are listed in Supplemental Table S1. Conditional mutants under the control of the repressible GAL10 promoter were generated by one-step PCR strategy in the strains YDL401 and BMA64. TAP-tagged strains were constructed by a one-step PCR strategy in the GAL-mediated strain GAL::rrp12 (Rigaut et al. 1999
). GFP-tagged strains were constructed by one-step PCR strategy in the wild-type strain BMA38 (MATa). Transformants were screened by immunoblotting and PCR. The RRP12TAP strain was transformed with pUN100DsRedNOP1 (kindly provided by E. Hurt, University of Heidelberg) to allow ready identification of the nucleolus, and the GAL::rrp12 strain was transformed with pRS315-rpl11bGFP (kindly provided by P. Silver, Dana Faber Institute) to study 60S ribosomal subunit export. Plasmids used and constructed in this study are listed in supplementary Table S2.
RNA extraction, Northern hybridization, and primer extension
For high molecular weight RNA analysis, 7 µg of total RNA was separated on a 1.2% agarose gel containing formaldehyde. Standard 6%, 8%, or 12% acrylamide-8 M urea gels were used to analyze low-molecular weight RNA species and primer extension reactions. Primer extensions were performed on 5 µg of total RNA. For pre-rRNA, rRNA analysis, and FISH, the following oligonucleotides were used: 002; 5'-GCTCTTTGCTCTTGCC; 004; 5'-CGGTTTTAATTGTCCTA; 007; 5'-CTCCGCTTATTGATATGC; 008; 5'-CATGGCTTAATCTTTGAGAC; 017; 5'-GCGTTGTTCATCGATGC; 020; 5'-TGAGAAGGAAATGACGCT; 026; 5'-CCAGATAACTATCTTAAAAG; 033; 5'-CGCTGCTCACCAATGG; 250, 5'-ATCCCGGCCGCCTCCATCAC; 306, 5'-GCATCTTACGATACCTG
Immunoprecipitation of Rrp12pTAP
Immunoprecipitation of Rrp12pTAP and subsequent TEV cleavage was performed as described by (Rigaut et al. 1999
), except for the addition of 2.5 mM vanadyl-ribonucleoside complexes (VRC) to buffer A. RNA was extracted with buffer AE/phenolchloroform, ethanol precipitated, and analyzed by Northern hybridization and primer extension, respectively. For Solution-binding assays, IgG bead were washed with 1.6M MgCl2 after overnight incubation with Rrp12pTAP lysate. Washed IgG beads were used for binding assay with GST-proteins.
Immunofluorescence
For localization of yeast Rrp12pTAP, the protein A region was detected with a rabbit anti-Protein A antibody (Sigma) and a secondary goat anti-rabbit antibody coupled to FITC (Sigma) at a 1:1000 and a 1:200 dilution, respectively. To stain nuclear DNA, DAPI was included in the mounting medium (Vecta-shield, Vector Laboratories).
Fluorescent in situ hybridization
Fluorescent in situ hybridization was performed in the GAL::rrp12 strain as previously described (Amberg et al. 1992
) with some modifications. The template for the ITS1-5' RNA, 5'-TGGACTC5CCATCTCTTGAC5TCTTGCCCAG5AAAAGCTC5CATGCTC5T-3', was a 50-bp oligonucleotide fluorescently labeled with Cy3. Cells were grown to an optical density of 0.51.0 at 600 nm and fixed with 2% (v/v) formaldehyde/5% (v/v) acetic acid for 10 min at 25°C. Samples were hybridized with 100 ng of Cy3-labeled RNA oligonucleotide for 16 h at 37°C.
Heterokaryon analysis
The heterokaryon assay was performed in the Rrp12pGFP strain as described previously (Flach et al. 1994
; Peng and Hopper 2000
) with the following modifications. Cells were incubated with cycloheximide at a concentration of 100 µg/µL for 5 min on ice. Mating was initiated by mixing 3 x 106 cells with an equal number of cells from the kar1-1 strain MS740 (kindly provided by M. Rose, Princeton University). Cells were concentrated on a 25-mm diameter, 0.45-µm pore nitrocellulose filter, and by placing the filter on a YPD plate. After 1, 1.5, and 2 h of incubation, cells were washed off the membrane using glucose-containing medium fixed with 4% (v/v) formaldehyde for 30 min at 25°C and spotted onto poly-L-lysine coated coverslips for observation.
Recombinant protein expression
GST-fused constructs were transformed into E. coli BL21 [LysS]. Recombinant GST-fusion proteins were purified as described by previously (Iovine et al. 1995
).
Solution-binding assay
[35S]-L-methionine-Rrp12p was expressed in vitro from a PCR-generated template (5'primer-ATTAATACGACTCACTATAGGGAGAGCCACCATGGATCAAGACAAGTTGCT;3'primer[T]40TCTCCAGGTGTGTAATTAGCCATATTGCTCAGT) using a Quick PCR T7 TNT kit (Promega).
A total of 2 µg of GSTGsp1p and 1 µg each of GSTNup116GLFG, GSTNup100GLFG, GSTNsp1pFF18, GSTRcc1p, GSTRrp41p, GSTRrp44p, and GST per 10 µL beads were bound to glutathione-agarose beads in 0.5-mL-binding buffer (20 mM Hepes at pH6.8, 150 mM potassium acetate, 2 mM MgCl2, 2 mM DTT, 0.1% Tween-20, 0.1% casamino acids) for 45 min at 4°C. GTP/GDP/GDPNP loading of GSTGsp1p was performed as previously described (Weis et al. 1996
). The reaction was terminated by addition of 30 mM MgCl2, and the beads washed with binding buffer to remove excess nucleotide. Efficiency of Gsp1pGTP/GDP binding was determined using [3H]GTP or [3H]GDP by filtration and liquid scintillation counting as described (Weis et al. 1996
). The binding of labeled Rrp12p to GST proteins and GST proteins to Rrp12pTAP was carried out as previously described (Rexach and Blobel 1995
). Binding of labeled Rrp12p to polyribonucleotides, tRNA, and pre-rRNA,was carried out under similar conditions, but in the presence of 25 mM MgCl2. tRNAsup3e and pre-rRNA were transcribed from a SP6 and T7 promoter, respectively, using biotin-16-UTP (Roche). A total of 100 ng of each biotinylated RNA was bound to Streptavidin-agarose and washed with low-salt buffer. After binding of labeled Rrp12p, the reactions were separated on a 3%8% Tris-Acetate or 4%12% Bis-Tris Novex gel (Invitrogen). The 3%8% Tris-Acetate gel was dried and exposed to a BMS film overnight at -80°C with an intensifying screen. The 4%12% Bis-Tris gel was immunoblotted and probed with anti-GST antibody conjugated to horseradish peroxidase. Bands were detected by ECL.
Sequence analysis and model building
The nonredundant protein database clustered at 70% identity was searched with PSI-BLAST (Altschul et al. 1997
) for 10 iterations or until convergence (E = 0.005). The database was searched separately for three iterations and the checkpoints were saved for secondary structure predictions (Jones 1999
). These predictions were also used for fold recognition by THREADER (Jones et al. 1992
). We also used 3D-PSSM (Kelley et al. 2000
; http://www.sbg.bio.ic.ac.uk/~3dpssm/) as an independent fold-recognition method. In both cases, fold recognition confirmed the results of sequence analysis with high significance. The best match in the 3D-PSSM analysis was the PR65/A subunit of PP2A (Groves et al. 1999
). Although Kap-
/Imp-
structure (Cingolani et al. 1999
) had only marginally less significant match than the PR65/A subunit of PP2A, it was less suitable as a template because its alignment with Rrp12 contained more insertions and deletions.
Automatic alignments produced by 3D-PSSM were manually corrected where needed and used to build an ensemble of 3D models (Sali and Blundell 1993
). The models were evaluated (Sanchez and Sali 1998
), and all had 0.97 or better probability of being correct without any further optimizations.
| Acknowledgments |
|---|
|
|
|---|
The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.
| Footnotes |
|---|
Article published online ahead of print. Article and publication date are at http://www.genesdev.org/cgi/doi/10.1101/gad.285604.
3 Corresponding author. E-MAIL d.tollervey{at}ed.ac.uk; FAX 44-131-650-7040. ![]()
| References |
|---|
|
|
|---|
Amberg, D.C., Goldstein, A.L., and Cole, C.N. 1992. Isolation and characterization of RAT1: An essential gene of Saccharomyces cerevisiae required for the efficient nucleocytoplasmic trafficking of mRNA. Genes & Dev. 6: 1173-1189.
Andersen, J.S., Lyon, C.E., Fox, A.H., Leung, A.K., Lam, Y.W., Steen, H., Mann, M., and Lamond, A.I. 2002. Directed proteomic analysis of the human nucleolus. Curr. Biol. 12: 1-11.[CrossRef][Medline]
Andrade, M.A., Petosa, C., O'Donoghue, S.I., Muller, C.W., and Bork, P. 2001. Comparison of ARM and HEAT protein repeats. J. Mol. Biol. 309: 1-18.[CrossRef][Medline]
Bayliss, R., Littlewood, T., and Stewart, M. 2000. Structural basis for the interaction between FxFG nucleoporin repeats and importin-
in nuclear trafficking. Cell 102: 99-108.[CrossRef][Medline]
Brand, R.C., Klootwijk, J., van Steenbergen, T.J.M., de Kok, A.J., and Planta, R.J. 1977. Secondary methylation of yeast ribosomal precursor RNA. Eur. J. Biochem. 75: 311-318.[Medline]
Briggs, M.W., Burkard, K.T., and Butler, J.S. 1998. Rrp6p, the yeast homologue of the human PM-Scl 100-kDa autoantigen, is essential for efficient 5.8 S rRNA 3' end formation. J. Biol. Chem. 273: 13255-13263.
Chook, Y.M. and Blobel, G. 1999. Structure of the nuclear transport complex karyopherin-
2-Ran x GppNHp. Nature 399: 230-237.[CrossRef][Medline]
____. 2001. Karyopherins and nuclear import. Curr. Opin. Struct. Biol. 11: 703-715.[CrossRef][Medline]
Cingolani, G., Petosa, C., Weis, K., and Muller, C.W. 1999. Structure of importin-
bound to the IBB domain of importin-
. Nature 399: 221-229.[CrossRef][Medline]
Dragon, F., Gallagher, J.E., Compagnone-Post, P.A., Mitchell, B.M., Porwancher, K.A., Wehner, K.A., Wormsley, S., Settlage, R.E., Shabanowitz, J., Osheim, Y., et al. 2002. A large nucleolar U3 ribonucleoprotein required for 18S ribosomal RNA biogenesis. Nature 417: 967-970.[CrossRef][Medline]
Eppens, N.A., Rensen, S., Granneman, S., Raue, H.A., and Venema, J. 1999. The roles of Rrp5p in the synthesis of yeast 18S and 5.8S rRNA can be functionally and physically separated. RNA 5: 779-793.[Abstract]
Flach, J., Bossie, M., Vogel, J., Corbett, A., Jinks, T., Willins, D.A., and Silver, P.A. 1994. A yeast RNA-binding protein shuttles between the nucleus and the cytoplasm. Mol. Cell. Biol. 14: 8399-8407.
Floer, M. and Blobel, G. 1996. The nuclear transport factor karyopherin
binds stoichiometrically to Ran-GTP and inhibits the Ran GTPase activating protein. J. Biol. Chem. 271: 5313-5316.
Gadal, O., Strauss, D., Kessl, J., Trumpower, B., Tollervey, D., and Hurt, E. 2001. Nuclear export of 60s ribosomal subunits depends on Xpo1p and requires a nuclear export sequence-containing factor, Nmd3p, that associates with the large subunit protein Rpl10p. Mol. Cell. Biol. 21: 3405-3415.
Gavin, A.C., Bosche, M., Krause, R., Grandi, P., Marzioch, M., Bauer, A., Schultz, J., Rick, J.M., Michon, A.M., Cruciat, C.M., et al. 2002. Functional organization of the yeast proteome by systematic analysis of protein complexes. Nature 415: 141-147.[CrossRef][Medline]
Gleizes, P.E., Noaillac-Depeyre, J., Leger-Silvestre, I., Teulieres, F., Dauxois, J.Y., Pommet, D., Azum-Gelade, M.C., and Gas, N. 2001. Ultrastructural localization of rRNA shows defective nuclear export of preribosomes in mutants of the Nup82p complex. J. Cell Biol. 155: 923-936.
Görlich, D., Kraft, R., Kostka, S., Vogel, F., Hartmann, E., Laskey, R.A., Mattaj, I.W., and Izaurraide, E. 1996. Importin provides a link between nuclear protein import and U snRNA export. Cell 87: 21-32.[CrossRef][Medline]
Görlich, D., Seewald, M.J., and Ribbeck, K. 2003. Characterization of Ran-driven cargo transport and the RanGTPase system by kinetic measurements and computer simulation. EMBO J. 22: 1088-1100.[CrossRef][Medline]
Grandi, P., Rybin, V., Bassler, J., Petfalski, E., Strauss, D., Marzioch, M., Schafer, T., Kuster, B., Tschochner, H., Tollervey, D., et al. 2002. 90S pre-ribosomes include the 35S pre-rRNA, the U3 snoRNP, and 40S subunit processing factors but predominantly lack 60S synthesis factors. Mol. Cell 10: 105-115.[CrossRef][Medline]
Groves, M.R., Hanlon, N., Turowski, P., Hemmings, B.A., and Barford, D. 1999. The structure of the protein phosphatase 2A PR65/A subunit reveals the conformation of its 15 tandemly repeated HEAT motifs. Cell 96: 99-110.[CrossRef][Medline]
Ho, J.H., Kallstrom, G., and Johnson, A.W. 2000. Nmd3p is a Crm1p-dependent adapter protein for nuclear export of the large ribosomal subunit. J. Cell. Biol. 151: 1057-1066.
Hurt, E., Hannus, S., Schmelzl, B., Lau, D., Tollervey, D., and Simos, G. 1999. A novel in vivo assay reveals inhibition of ribosomal nuclear export in ran-cycle and nucleoporin mutants. J. Cell. Biol. 144: 389-401.
Ihmels, J., Friedlander, G., Bergmann, S., Sarig, O., Ziv, Y., and Barkai, N. 2002. Revealing modular organization in the yeast transcriptional network. Nat. Genet. 31: 370-377.[CrossRef][Medline]
Iovine, M.K., Watkins, J.L., and Wente, S.R. 1995. The GLFG repetitive region of the nucleoporin Nup116p interacts with Kap95p, an essential yeast nuclear import factor. J. Cell Biol. 131: 1699-1713.
Jones, D.T. 1999. Protein secondary structure prediction based on position-specific scoring matrices. J. Mol. Biol. 292: 195-202.[CrossRef][Medline]
Jones, D.T., Taylor, W.R., and Thornton, J.M. 1992. A new approach to protein fold recognition. Nature 358: 86-89.[CrossRef][Medline]
Kelley, L.A., MacCallum, R.M., and Sternberg, M.J. 2000. Enhanced genome annotation using structural profiles in the program 3D-PSSM. J. Mol. Biol. 299: 499-520.[Medline]
Kraulis, P.J. 1991. MOLSCRIPT: A program to produce both detailed and schematic plots of protein structures. J. Appl. Crystallogr. 24: 946-950.[CrossRef]
Kuersten, S., Ohno, M., and Mattaj, I.W. 2001. Nucleocytoplasmic transport: Ran,
and beyond. Trends Cell Biol. 11: 497-503.[CrossRef][Medline]
Kunzler, M. and Hurt, E. 2001. Targeting of Ran: Variation on a common theme? J. Cell Sci. 114: 3233-3241.
Lee, S.J., Imamoto, N., Sakai, H., Nakagawa, A., Kose, S., Koike, M., Yamamoto, M., Kumasaka, T., Yoneda, Y., and Tsukihara, T. 2000. The adoption of a twisted structure of importin-
is essential for the protein-protein interaction required for nuclear transport. J. Mol. Biol. 302: 251-264.[CrossRef][Medline]
Maurer, P., Redd, M., Solsbacher, J., Bischoff, F.R., Greiner, M., Podtelejnikov, A.V., Mann, M., Stade, K., Weis, K., and Schlenstedt, G. 2001. The nuclear export receptor Xpo1p forms distinct complexes with NES transport substrates and the yeast Ran binding protein 1 (Yrb1p). Mol. Biol. Cell 12: 539-549.
Merritt, E.A. and Bacon, D.J. 1997. Raster3D: Photorealistic molecular graphics. Methods Enzymol. 277: 505-524.[Medline]
Milkereit, P., Gadal, O., Podtelejnikov, A., Trumtel, S., Gas, N., Petfalski, E., Tollervey, D., Mann, M., Hurt, E., and Tschochner, H. 2001. Maturation and intranuclear transport of preribosomes requires Noc proteins. Cell 105: 499-509.[CrossRef][Medline]
Milkereit, P., Strauss, D., Bassler, J., Gadal, O., Kuhn, H., Schutz, S., Gas, N., Lechner, J., Hurt, E., and Tschochner, H. 2003. A Noc complex specifically involved in the formation and nuclear export of ribosomal 40 S subunits. J. Biol. Chem. 278: 4072-4081.
Mitchell, P., Petfalski, E., Shevchenko, A., Mann, M., and Tollervey, D. 1997. The exosome; a conserved eukaryotic RNA processing complex containing multiple 3'
5'exoribonuclease activities. Cell 91: 457-466.[CrossRef][Medline]
Moy, T.I. and Silver, P.A. 1999. Nuclear export of the small ribosomal subunit requires the ran-GTPase cycle and certain nucleoporins. Genes & Dev. 13: 2118-2133.
____. 2002. Requirements for the nuclear export of the small ribosomal subunit. J. Cell Sci. 115: 2985-2995.
Nicholls, A., Sharp, K.A., and Honig, B. 1991. Protein folding and association: Insights from the interfacial and thermodynamic properties of hydrocarbons. Proteins 11: 281-296.[CrossRef][Medline]
Oeffinger, M. and Tollervey, D. 2003. Yeast Nop15p is an RNA binding protein required for pre-ribosomal RNA processing and cytokinesis. EMBO J. 22: 6573-6583.[CrossRef][Medline]
Peng, G. and Hopper, J.E. 2000. Evidence for Gal3p's cytoplasmic location and Gal18p's dual cytoplasmic-nuclear location implicates new mechanisms for controlling Gal4p activity in Saccharomyces cerevisiae. Mol. Cell. Biol. 20: 5140-5148.