|
|
|
RESEARCH COMMUNICATION
1 Department of Molecular and Cellular Biology, 2 Department of Molecular and Human Genetics, 3 Department of Dermatology, 4 Biology of Inflammation Center and Department of Medicine, Baylor College of Medicine, Houston, Texas 77030, USA; 5 Laboratory for Cutaneous Biology, Dermatology Unit, Beaumont Hospital, CHUV, Lausanne CH-1011, Switzerland
| Abstract |
|---|
|
|
|---|
[Keywords: Spink5; LektI; proteinase inhibitor; Netherton Syndrome; desmosomes; Cdsn]
Received June 17, 2004; revised version accepted August 6, 2004.
| Results and Discussion |
|---|
|
|
|---|
25% of the newborn offspring developed severe skin blistering and water barrier defects, leading to death within several hours after birth (Fig. 1A). This observation suggested that this transgenic line carried a recessive lethal insertional mutation.
|
PCR walking was used to identify the other integration junction (see Supplemental Material). The left junction was found to be 3.8 kb upstream of the start codon of the 2310065D10Rik gene. Integration of the transgenic DNA was accompanied by a deletion of 66.8 kb in mouse chromosome 18, including the entire coding region of 2310065D10Rik, but excluding any exons from the predicted adjacent genes (Fig. 1B). The adjacent genes (Loc225443 and Ttid) are expressed at normal levels by RT-PCR analysis in the mutant newborns (Supplementary Fig. S3).
The human cDNA with the highest homology (68%) to 2310065D10Rik is the SPINK5 cDNA. SPINK5 maps to chromosome 5q32, which is syntenic to mouse chromosome 18B3. SPINK5 has 33 exons and 2310065D10Rik has 32 exons. The positions of the exon-intron junctions are well conserved between mouse and human (see Supplementary Fig. S4). On the basis of the homology of the genes and the similarity of the mutant phenotypes, we propose that 2310065D10Rik and the protein encoded by this gene should be named Spink5 and LektI, respectively, and we will refer to them as such. The protein sequence of LektI is 58% identical and 71% homologous to human LEKTI. The two proteins have a similar domain organization, including two Kazal-type domains, domains 2 and 15 (Supplementary Fig. S4). Domain 6 of LEKTI is completely absent from LektI. In addition, there are 30 extra amino acids between domains 13 and 14 in LektI (Supplementary Fig. S4). We also compared LektI with the putative rat LektI protein (rLektI), which is encoded by Loc361319 (XM_341607 [GenBank] ) (Supplementary Fig. S4).
Spink5 expression in perinatal skin was analyzed by RT-PCR (Fig. 2A). Expression was detected in wild-type prenatal (embryonic days 16.5-18.5 [E16.5-E18.5]) and neonatal (P0) skin (Fig. 2A). No transcript was amplified from homozygous mutant skin. By in situ hybridization, Spink5 transcripts were detected specifically in the upper spinous and granular layers of newborn skin (Fig. 2B). The transcript was also detected in hair follicles of adult skin (Fig. 2B). This expression pattern is similar to that reported for human SPINK5 (Komatsu et al. 2003
).
|
|
-glycosidase activity. At E17.5 and E19, mutant skin was largely unstained, which showed evidence for skin-barrier formation. Nevertheless, focal lack of barrier function (i.e., blue staining) was observed in the articular regions such as the knees, elbows, cheeks, and neck (Fig. 3B). After birth, Spink5-/- mice stained blue over their entire body surface, demonstrating complete loss of barrier function (Fig. 3B). These results are reminiscent of clinical observations in neonatal patients with severe NS, where skin lesions occur preferentially in articular regions and aggravate soon after birth with generalized exfoliative erythroderma (Komatsu et al. 2002
Transmission electron microscopy on skin samples from newborn Spink5-/- and wild-type littermates revealed abnormal cornification in the mutant mice (Fig. 4C). Specifically, we observed loosely interconnected corneocytes that contained abnormal low electron-dense vesicles in their cytoplasm (Fig. 4F), a phenomenon observed in human NS samples as well (Muller et al. 2002
). Furthermore, we found a distinctive architectural loss of cell-cell adhesion (acantholysis) in the granular layer of mutant epidermis (Fig. 4D). Half desmosomes with attached keratin filaments were visible at the plasma membranes of most granular cells (Fig. 4E). This desmosomal defect is reminiscent of the ultrastructural lesions observed in the skin of pemphigus foliaceus (PF) patients, who suffer from suprabasal intraepidermal blistering due to the presence of Dsg1 auto-antibodies (Stanley 2000
; Stanley et al. 2001
).
|
|
To determine whether Dsg1, Dsc1, or Cdsn (mouse ortholog of human CDSN, XP_111684
[GenBank]
), were affected in newborn Spink5-/- skin, we used Western blotting with Triton X-100 (TX 100)-soluble and TX 100-insoluble protein extracts (Fig. 5B). The TX-100-insoluble fraction contains proteins integrated into mature desmosomes. Dsc1 and Dsg1 are mainly present in the TX 100-insoluble fraction (Pasdar and Nelson 1988
). Using Dsc1 and Dsg1/2 antibodies (Cheng et al. 2004
), we did not detect a significant reduction in the steady-state level of Dsc1 or Dsg1/2 in either the TX 100-soluble or TX 100-insoluble fractions of Spink5-/- skin (Fig. 5B).
Next, we probed Western blots with an antibody (F28-F27) generated against human CDSN (Montezin et al. 1997
). In humans, this antibody recognizes three clusters of bands as follows: a full-length cluster (52-56 kDa), which is mainly found in the keratinosomes and present in the detergent-soluble pool; an intermediate-size cluster (40-48 kDa), which primarily exists in the detergent-insoluble fraction and is thought to contribute to desmosome stabilization; and a small-size cluster (33-36 kDa), which is normally present in the uppermost SC, and probably lacks adhesive properties (Montezin et al. 1997
; Simon et al. 1997
, 2001
). In mouse skin, F28-F27 also recognizes three Cdsn clusters, but the sizes are slightly different from those observed in humans, that is, 75 kDa, 45-60 kDa, and 36-40 kDa, respectively (Montezin et al. 1997
). The intermediate-sized 45-60-kDa cluster seen in wild-type skin was nearly absent in Spink5-/- skin, and instead, nearly all of the insoluble Cdsn was 36-40 kDa, which could be caused by inappropriately premature proteolysis (Fig. 5B). On the basis of these results, we hypothesize that in the absence of LektI, the premature proteolysis of Cdsn/CDSN in Spink5-/- mice/NS patients may contribute significantly to desmosomal fragility, epidermal detachment, and skin barrier defects.
CDSN degradation and dissolution of corneodesmosome-mediated adhesion are normal processes in the stratum corneum. In our mouse model, as well as human NS patients, absence of LektI/LEKT1 leads to a premature activation of proteinases involved in this process. Serine proteinases SCCE (stratum corneum trypsin-like enzyme) (Hansson et al. 1994
) and SCTE (stratum corneum chymotrypsin-like enzyme) (Brattsand and Egelrud 1999
), which are synthesized in granular cells and secreted into the intercellular space, can both digest human CDSN-producing proteolytic products of 30-33 kDa (Simon et al. 2001
; Caubet et al. 2004
). They may cooperate with LEKTI to regulate the CDSN stability in the suprabasal epidermis.
Mutations that produce truncated forms of CDSN have been described in humans (Levy-Nissenbaum et al. 2003
). These mutations lead to a dominant hair disorder (hypotrichosis simplex of the scalp), implying that CDSN plays a role in hair-follicle growth and maintenance (Levy-Nissenbaum et al. 2003
). So far, no homozygous CDSN/Cdsn mutants have been reported in humans or mice.
In summary, our results show a link between NS skin defects and impaired desmosome function in the subcorneal epidermis, and provide a possible molecular mechanism for the pathogenesis of NS. Spink5-/- mice mimic severe NS, and can be used to design and test perinatal therapies for treatment of the disease. In addition, our mouse can be used to study desmosomal maturation and stabilization in the suprabasal layers of the epidermis.
| Materials and methods |
|---|
|
|
|---|
Tail and yolk sack DNA samples were used as PCR templates. Primers R3 (CCACTGGGAATGTGATGAAAGAAATAAAAGC), R-WT-s (GGCATATAGTGTGTTTGGAGC), and R-WT-as (GGCATCCATTAGTTTATCTCTTACTCCAG) were designed based on the right insertional junction (Fig. 1B). R3 and R-WT-as generate a 272-bp band from the mutant allele. R-WT-s and R-WT-as produce a 247-bp band from the wild-type allele.
RT-PCR
Total RNA from wild-type and mutant dorsal skin was extracted with the RNeasy Mini Kit (QIAGEN). First-strand cDNA was synthesized using the Superscript cDNA first strand synthesis kit (Invitrogen). Spink5-exon3-s (TGGTACACTGACGTGTCCCAAAG) and Spink5-exon7-as (GGATTGGATCACTTTCCCGTGT) primers were used to amplify a 434-bp Spink5 cDNA from wild-type samples. HPRT-s (ATGACCTAGATTTGTTTTGTATACC) and HPRT-as (GTAGCTCTTCAGTCTGATAAAATCTAC) primers were used to amplify hypoxanthine-guanine phosphoribosyltransferase (HPRT) cDNA as a positive control.
Epidermal permeability assay
Embryos or neonates were briefly washed with 0.9% NaCl and immediately immersed into acidic X-gal mix (100 mM phosphate buffer at pH 4.3, 3 mM K3Fe(CN)6, 3 mM K4Fe(CN)6, 2 mM MgCl2 1 mg/mL X-gal), then incubated for 8 h at room temperature in the dark (Hardman et al. 1998
). To avoid damage to the neonatal epidermis, we separated pups from their mothers immediately after birth. In the absence of a mature epidermal barrier, X-gal penetrates into the cells of the epidermis where it is hydrolyzed to produce a blue color.
In situ hybridization
A Spink5 cDNA fragment generated by RT-PCR with Spink5-exon3-s and Spink5-exon7-as primers was subcloned into the pGEM-T easy vector (Promega) and used as a template for generating an antisense RNA Probe. Digoxygenin-UTP, T7 RNA polymerase, and the Dig Nucleic Acid Detection Kit (Roche) were used to label the probe and to detect hybridization. (The nonradioactive in situ Protocol is described online at http://www.roche-applied-science.com/prod_inf/manuals/InSitu/pdf/ISH_149-163.pdf.)
In situ zymogram
BODIPYL FL casein, green fluorescein conjugate (EnzChek Proteinase Assay Kit; Molecular Probes) was used for in situ zymography (ISZ) (Kheradmand et al. 2002
). Briefly, the intramolecularly quenched substrate (BODIPYL FL casein) was reconstituted according to the manufacturer's recommendations and was diluted 1:1 in 1% agar immediately before addition to cryostat sections of newborn skin, followed by an incubation for up to 24 h at 37°C. Fluorescence intensity was monitored every 2 h forthe first 10 h, then at 24 h. Skin sections from wild-type and Spink5-/- mice were photographed at equal time points and exposure time. For inhibition of serine proteinase activity, cryostat sections of the skin were incubated with 100 mM of soybean trypsin inhibitor (SBTI, Boehringer Mannheim).
Western blots
P0 dorsal skin was pulverized in liquid nitrogen and extracted for 15 min in lysis buffer (10 mM Tris-Cl at pH 7.4, 5 mM EDTA, 100 mM NaCl, 1% Triton X-100 with Complete Proteinase Inhibitors Cocktail from Roche). Soluble and insoluble fractions were separated by centrifugation. The insoluble pellets were dissolved with 5x Laemmli buffer (0.05 M Tris-Cl, 4% SDS, 8% glycerol, with 20%
-Mercaptoethanol) at 100°C for 20 min. Equal amounts of protein (determined using the Protein Assay Dye Reagent from Bio-Rad) were fractionated on 4%-15% gradient SDS-polyacrylamide gels (Bio-Rad), then transferred to PVDF membranes (Bio-Rad). The following primary antibodies were used: Dsg3.10 (1:800; from RDI, detects Dsg1/2), Dsc1 antibody (Cheng et al. 2004
) (1:800), and corneodesmosin antibody F28-F27 (1:1000, from Dr. Guy Serre, University of Toulouse III, Toulouse, France).
| Acknowledgments |
|---|
|
|
|---|
| Footnotes |
|---|
Article and publication are at http://www.genesdev.org/cgi/doi/10.1101/gad.1232104.
6 E-MAIL taoy{at}bcm.tmc.edu; FAX (713) 798-5168. ![]()
7 E-MAIL overbeek{at}bcm.tmc.edu; FAX (713) 798-7819. ![]()
| References |
|---|
|
|
|---|
Brattsand, M. and Egelrud, T. 1999. Purification, molecular cloning, and expression of a human stratum corneum trypsin-like serine protease with possible function in desquamation. J. Biol. Chem. 274: 30033-30040.
Caubet, C., Jonca, N., Brattsand, M., Guerrin, M., Bernard, D., Schmidt, R., Egelrud, T., Simon, M., and Serre, G. 2004. Degradation of corneodesmosome proteins by two serine proteases of the kallikrein family, SCTE/KLK5/hK5 and SCCE/KLK7/hK7. J. Invest Dermatol. 122: 1235-1244.[CrossRef][Medline]
Chavanas, S., Bodemer, C., Rochat, A., Hamel-Teillac, D., Ali, M., Irvine, A.D., Bonafe, J.L., Wilkinson, J., Taieb, A., Barrandon, Y., et al. 2000. Mutations in SPINK5, encoding a serine protease inhibitor, cause Netherton syndrome. Nat. Genet. 25: 141-142.[CrossRef][Medline]
Cheng, X. and Koch, P.J. 2004. In vivo function of desmosomes. J. Dematol. 31: 171-187.
Cheng, X., Mihindukulasuriya, K., Den, Z., Kowalczyk, A.P., Calkins, C.C., Ishiko, A., Shimizu, A., and Koch, P.J. 2004. Assessment of splice variant-specific functions of desmocollin 1 in the skin. Mol. Cell Biol. 24: 154-163.
Garrod, D.R., Merritt, A.J., and Nie, Z. 2002a. Desmosomal adhesion: Structural basis, molecular mechanism and regulation (Review). Mol. Membr. Biol. 19: 81-94.[CrossRef][Medline]
____. 2002b. Desmosomal cadherins. Curr. Opin. Cell Biol. 14: 537-545.[CrossRef][Medline]
Hansson, L., Stromqvist, M., Backman, A., Wallbrandt, P., Carlstein, A., and Egelrud, T. 1994. Cloning, expression, and characterization of stratum corneum chymotryptic enzyme. A skin-specific human serine proteinase. J. Biol. Chem. 269: 19420-19426.
Hardman, M.J., Sisi, P., Banbury, D.N., and Byrne, C. 1998. Patterned acquisition of skin barrier function during development. Development 125: 1541-1552.[Abstract]
Ivics, Z., Hackett, P.B., Plasterk, R.H., and Izsvak, Z. 1997. Molecular reconstruction of Sleeping Beauty, a Tc1-like transposon from fish, and its transposition in human cells. Cell 91: 501-510.[CrossRef][Medline]
Jonca, N., Guerrin, M., Hadjiolova, K., Caubet, C., Gallinaro, H., Simon, M., and Serre, G. 2002. Corneodesmosin, a component of epidermal corneocyte desmosomes, displays homophilic adhesive properties. J. Biol. Chem. 277: 5024-5029.
Judge, M.R., Morgan, G., and Harper, J.I. 1994. A clinical and immunological study of Netherton's syndrome. Br. J. Dermatol. 131: 615-621.[CrossRef][Medline]
Kheradmand, F., Rishi, K., and Werb, Z. 2002. Signaling through the EGF receptor controls lung morphogenesis in part by regulating MT1-MMP-mediated activation of gelatinase A/MMP2. J. Cell Sci. 115: 839-848.
Komatsu, N., Takata, M., Otsuki, N., Ohka, R., Amano, O., Takehara, K., and Saijoh, K. 2002. Elevated stratum corneum hydrolytic activity in Netherton syndrome suggests an inhibitory regulation of desquamation by SPINK5-derived peptides. J. Invest Dermatol. 118: 436-443.[CrossRef][Medline]
Komatsu, N., Takata, M., Otsuki, N., Toyama, T., Ohka, R., Takehara, K., and Saijoh, K. 2003. Expression and localization of tissue kallikrein mRNAs in human epidermis and appendages. J. Invest Dermatol. 121: 542-549.[CrossRef][Medline]
Krafchik, B.R. and Toole, J.W. 1983. What is Netherton's syndrome? Int. J. Dermatol. 22: 459-462.[Medline]
Levy-Nissenbaum, E., Betz, R.C., Frydman, M., Simon, M., Lahat, H., Bakhan, T., Goldman, B., Bygum, A., Pierick, M., Hillmer, A.M., et al. 2003. Hypotrichosis simplex of the scalp is associated with nonsense mutations in CDSN encoding corneodesmosin. Nat. Genet. 34: 151-153.[CrossRef][Medline]
Magert, H.J., Standker, L., Kreutzmann, P., Zucht, H.D., Reinecke, M., Sommerhoff, C.P., Fritz, H., and Forssmann, W.G. 1999. LEKTI, a novel 15-domain type of human serine proteinase inhibitor. J. Biol. Chem. 274: 21499-21502.
Mitsudo, K., Jayakumar, A., Henderson, Y., Frederick, M.J., Kang, Y., Wang, M., El Naggar, A.K., and Clayman, G.L. 2003. Inhibition of serine proteinases plasmin, trypsin, subtilisin A, cathepsin G, and elastase by LEKTI: A kinetic analysis. Biochemistry 42: 3874-3881.[CrossRef][Medline]
Montezin, M., Simon, M., Guerrin, M., and Serre, G. 1997. Corneodesmosin, a corneodesmosome-specific basic protein, is expressed in the cornified epithelia of the pig, guinea pig, rat, and mouse. Exp. Cell Res. 231: 132-140.[CrossRef][Medline]
Muller, F.B., Hausser, I., Berg, D., Casper, C., Maiwald, R., Jung, A., Jung, H., and Korge, B.P. 2002. Genetic analysis of a severe case of Netherton syndrome and application for prenatal testing. Br. J. Dermatol. 146: 495-499.[CrossRef][Medline]
Ochman, H., Gerber, A.S., and Hartl, D.L. 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120: 621-623.
Pasdar, M. and Nelson, W.J. 1988. Kinetics of desmosome assembly in Madin-Darby canine kidney epithelial cells: Temporal and spatial regulation of desmoplakin organization and stabilization upon cell-cell contact. I. Biochemical analysis. J. Cell Biol. 106: 677-685.
Schwarz, M.A., Owaribe, K., Kartenbeck, J., and Franke, W.W. 1990. Desmosomes and hemidesmosomes: Constitutive molecular components. Annu. Rev. Cell Biol. 6: 461-491.[CrossRef][Medline]
Simon, M., Montezin, M., Guerrin, M., Durieux, J.J., and Serre, G. 1997. Characterization and purification of human corneodesmosin, an epidermal basic glycoprotein associated with corneocyte-specific modified desmosomes. J. Biol. Chem. 272: 31770-31776.
Simon, M., Jonca, N., Guerrin, M., Haftek, M., Bernard, D., Caubet, C., Egelrud, T., Schmidt, R., and Serre, G. 2001. Refined characterization of corneodesmosin proteolysis during terminal differentiation of human epidermis and its relationship to desquamation. J. Biol. Chem. 276: 20292-20299.
Sprecher, E., Chavanas, S., DiGiovanna, J.J., Amin, S., Nielsen, K., Prendiville, J.S., Silverman, R., Esterly, N.B., Spraker, M.K., Guelig, E., et al. 2001. The spectrum of pathogenic mutations in SPINK5 in 19 families with Netherton syndrome: Implications for mutation detection and first case of prenatal diagnosis. J. Invest Dermatol. 117: 179-187.[CrossRef][Medline]
Stanley, J.R. 2000. The pathophysiology of pemphigus. J. Dermatol. Sci. 24: 155-157.[Medline]
Stanley, J.R., Nishikawa, T., Diaz, L.A., and Amagai, M. 2001. Pemphigus: Is there another half of the story? J. Invest Dermatol. 116: 489-490.[CrossRef][Medline]
Walden, M., Kreutzmann, P., Drogemuller, K., John, H., Forssmann, W.G., and Hans-Jurgen, M. 2002. Biochemical features, molecular biology and clinical relevance of the human 15-domain serine proteinase inhibitor LEKTI. Biol. Chem. 383: 1139-1141.[CrossRef][Medline]
Walley, A.J., Chavanas, S., Moffatt, M.F., Esnouf, R.M., Ubhi, B., Lawrence, R., Wong, K., Abecasis, G.R., Jones, E.Y., Harper, J.I., et al. 2001. Gene polymorphism in Netherton and common atopic disease. Nat. Genet. 29: 175-178.[CrossRef][Medline]
Yokoyama, T., Silversides, D.W., Waymire, K.G., Kwon, B.S., Takeuchi, T., and Overbeek, P.A. 1990. Conserved cysteine to serine mutation in tyrosinase is responsible for the classical albino mutation in laboratory mice. Nucleic Acids Res. 18: 7293-7298.
![]()
CiteULike
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
M. Matsumoto, Y. Zhou, S. Matsuo, H. Nakanishi, K. Hirose, H. Oura, S. Arase, A. Ishida-Yamamoto, Y. Bando, K. Izumi, et al. Targeted deletion of the murine corneodesmosin gene delineates its essential role in skin and hair physiology PNAS, May 6, 2008; 105(18): 6720 - 6724. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Sevilla, R. Nachat, K. R. Groot, J. F. Klement, J. Uitto, P. Djian, A. Maatta, and F. M. Watt Mice deficient in involucrin, envoplakin, and periplakin have a defective epidermal barrier J. Cell Biol., December 31, 2007; 179(7): 1599 - 1612. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. List, B. Currie, T. C. Scharschmidt, R. Szabo, J. Shireman, A. Molinolo, B. F. Cravatt, J. Segre, and T. H. Bugge Autosomal Ichthyosis with Hypotrichosis Syndrome Displays Low Matriptase Proteolytic Activity and Is Phenocopied in ST14 Hypomorphic Mice J. Biol. Chem., December 14, 2007; 282(50): 36714 - 36723. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Deraison, C. Bonnart, F. Lopez, C. Besson, R. Robinson, A. Jayakumar, F. Wagberg, M. Brattsand, J. P. Hachem, G. Leonardsson, et al. LEKTI Fragments Specifically Inhibit KLK5, KLK7, and KLK14 and Control Desquamation through a pH-dependent Interaction Mol. Biol. Cell, September 1, 2007; 18(9): 3607 - 3619. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P Read, R A. Word, M. A Ruscheinsky, B. C Timmons, and M. S Mahendroo Cervical remodeling during pregnancy and parturition: molecular characterization of the softening phase in mice Reproduction, August 1, 2007; 134(2): 327 - 340. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Patel, Z. F. Xi, E. Y. Seo, D. McGaughey, and J. A. Segre Klf4 and corticosteroids activate an overlapping set of transcriptional targets to accelerate in utero epidermal barrier acquisition PNAS, December 5, 2006; 103(49): 18668 - 18673. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Netzel-Arnett, B. M. Currie, R. Szabo, C.-Y. Lin, L.-M. Chen, K. X. Chai, T. M. Antalis, T. H. Bugge, and K. List Evidence for a Matriptase-Prostasin Proteolytic Cascade Regulating Terminal Epidermal Differentiation J. Biol. Chem., November 3, 2006; 281(44): 32941 - 32945. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. List, R. Szabo, A. Molinolo, B. S. Nielsen, and T. H. Bugge Delineation of Matriptase Protein Expression by Enzymatic Gene Trapping Suggests Diverging Roles in Barrier Function, Hair Formation, and Squamous Cell Carcinogenesis Am. J. Pathol., May 1, 2006; 168(5): 1513 - 1525. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-F. Galliano, E. Toulza, H. Gallinaro, N. Jonca, A. Ishida-Yamamoto, G. Serre, and M. Guerrin A Novel Protease Inhibitor of the {alpha}2-Macroglobulin Family Expressed in the Human Epidermis J. Biol. Chem., March 3, 2006; 281(9): 5780 - 5789. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Hewett, A. L. Simons, N. E. Mangan, H. E. Jolin, S. M. Green, P. G. Fallon, and A. N.J. McKenzie Lethal, neonatal ichthyosis with increased proteolytic processing of filaggrin in a mouse model of Netherton syndrome Hum. Mol. Genet., January 15, 2005; 14(2): 335 - 346. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||